camk2b1

Ensembl ID:
ENSDARG00000011065
ZFIN IDs:
ZDB-GENE-030131-9588, ZDB-GENE-070615-17, ZDB-GENE-070615-17
Description:
Novel protein similar to vertebrate calcium/calmodulin-dependent protein kinase (CaM kinase) II gamm
Human Orthologue:
CAMK2B
Human Description:
calcium/calmodulin-dependent protein kinase II beta [Source:HGNC Symbol;Acc:1461]
Mouse Orthologue:
Camk2b
Mouse Description:
calcium/calmodulin-dependent protein kinase II, beta Gene [Source:MGI Symbol;Acc:MGI:88257]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38460 Nonsense Mutation detected in F1 DNA During 2016
sa20381 Nonsense Available for shipment Available now
sa38459 Nonsense Mutation detected in F1 DNA During 2016
sa40398 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33574 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40397 Nonsense Mutation detected in F1 DNA During 2016
sa10362 Essential Splice Site Available for shipment Available now
sa18507 Essential Splice Site Available for shipment Available now
sa18200 Essential Splice Site Available for shipment Available now
sa38458 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 55 351 3 14
ENSDART00000098667 Nonsense 55 590 3 21
ENSDART00000133461 Nonsense 55 618 3 22
Genomic Location (Zv9):
Chromosome 5 (position 22795573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20508445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTATAAAATAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCAT[C/T]AGAAGCTGGAACGAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 59 351 3 14
ENSDART00000098667 Nonsense 59 590 3 21
ENSDART00000133461 Nonsense 59 618 3 22
Genomic Location (Zv9):
Chromosome 5 (position 22795561)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20508433
KASP Assay ID:
2259-5657.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCATCAGAAGCTGGAA[C/T]GAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAACATCGGTAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 91 351 4 14
ENSDART00000098667 Nonsense 91 590 4 21
ENSDART00000133461 Nonsense 91 618 4 22
Genomic Location (Zv9):
Chromosome 5 (position 22795319)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20508191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCATGACAGTATATCAGAGGAGGGCTTCCACTACCTACTCTTTGATT[T/A]GTAAGTGTCAGTGCACTTCCTGCTAGAATGTTCCTCCATTTCCTGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Essential Splice Site 137 351 6 14
ENSDART00000098667 Essential Splice Site 137 590 6 21
ENSDART00000133461 Essential Splice Site 137 618 6 22
Genomic Location (Zv9):
Chromosome 5 (position 22775163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20488035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGTGCTTCACTGCCATCAAATGGGTGTGGTGCACCGAGACCTGAAGG[T/C]AAGTGACGAATGTGATGTCATCGCTGTCCTTCAAGTGTGTAAACAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Essential Splice Site 315 351 12 14
ENSDART00000098667 Essential Splice Site 315 590 12 21
ENSDART00000133461 Essential Splice Site 315 618 12 22
Genomic Location (Zv9):
Chromosome 5 (position 22764865)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20477737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGGGCGCCATCCTCACCACCATGCTTGTGTCACGAAACTTCTCTGG[T/G]AAGTGACTTGTGTGAGTCAGAGCTGAAATCTAACCTTTGAACTGTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Nonsense 413 590 16 21
ENSDART00000133461 Nonsense 428 618 17 22
Genomic Location (Zv9):
Chromosome 5 (position 22724274)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20437146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTTGTTGCTGCCCCCTCTACTCCCCAGACCCCCAGCATCCCCACA[C/T]AGAGTAAGTCCCAGATGGACCCGTACTGAGGAACCAACATATTTGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
Genomic Location (Zv9):
Chromosome 5 (position 22721049)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433921
KASP Assay ID:
2259-5656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCWGTTATTTGTGATGGCTRATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
Genomic Location (Zv9):
Chromosome 5 (position 22721049)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433921
KASP Assay ID:
2259-5656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCWGTTATTTGTGATGGCTRATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
Genomic Location (Zv9):
Chromosome 5 (position 22721049)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433921
KASP Assay ID:
2259-5656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCWGTTATTTGTGATGGCTRATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753   None 351 None 14
ENSDART00000098667 Nonsense 548 590 21 21
ENSDART00000133461 Nonsense 576 618 21 22
Genomic Location (Zv9):
Chromosome 5 (position 22720873)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCTGATTGGAGAAGAGGCCGCCTGCATTGCCTACATCCGCCTCACA[C/T]AGTATGTGGATGGCCAGGGCCGACCGCGCAGCAGCCAATCAGAGGAGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link