fbxo9

Ensembl ID:
ENSDARG00000011055
ZFIN ID:
ZDB-GENE-030131-4194
Description:
F-box only protein 9 isoform 1 [Source:RefSeq peptide;Acc:NP_956012]
Human Orthologue:
FBXO9
Human Description:
F-box protein 9 [Source:HGNC Symbol;Acc:13588]
Mouse Orthologue:
Fbxo9
Mouse Description:
f-box protein 9 Gene [Source:MGI Symbol;Acc:MGI:1918788]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35402 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019989   None 334 None 11
ENSDART00000102767 Nonsense 232 421 8 13
Genomic Location (Zv9):
Chromosome 13 (position 2212492)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2221482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGCTGCACTAAAATGCTGCCCTATTCATCCTGGAGGGAGATGTTTT[T/A]GGAGAGGCCGCGTGTGCGCTTTGATGGTAAACACGTGTATTTGTGTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link