si:ch211-8a9.3

Ensembl ID:
ENSDARG00000011042
ZFIN ID:
ZDB-GENE-040724-229
Description:
piggyBac transposable element-derived protein 5 [Source:RefSeq peptide;Acc:NP_001139077]
Human Orthologue:
PGBD5
Human Description:
piggyBac transposable element derived 5 [Source:HGNC Symbol;Acc:19405]
Mouse Orthologue:
Pgbd5
Mouse Description:
piggyBac transposable element derived 5 Gene [Source:MGI Symbol;Acc:MGI:2429955]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42197 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35479 Nonsense Mutation detected in F1 DNA During 2017
sa9658 Nonsense Available for shipment Available now
sa14201 Essential Splice Site Available for shipment Available now
sa6298 Nonsense Mutation detected in F1 DNA During 2017
sa42198 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Essential Splice Site 103 518 1 7
Genomic Location (Zv9):
Chromosome 13 (position 24247277)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23892937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCGATACGCTGCGGGACCTCAGCCTGCCTCACTACCAGGACACGCACG[G/A]TAAGTTGGTGTAACGGTGATGAACGCTGATTAGTGTAAATGCAATGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 175 518 2 7
Genomic Location (Zv9):
Chromosome 13 (position 24258036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23903696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATGAAAGCATTTCTAGGCTACGTTACATCTACTAGCGTGAACCGCTG[T/A]GAGTCGGTGTTAAGCATCTGGAGCAGTGGTTTCTTCAGTAACCGCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 401 518 5 7
Genomic Location (Zv9):
Chromosome 13 (position 24273900)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23919560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAGTCTCATGTTAAGATGAGAGGAAATATGTCCATAATCAACTGGTA[C/A]AACAAAGGCAACTTCAGGTTTCTCACTAATGCCTACTCTCCTACTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Essential Splice Site 419 518 5 7
Genomic Location (Zv9):
Chromosome 13 (position 24273954)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23919614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGCAACTTCAGGTTTCTCACTAATGCCTACTCTCCTACTAAAGAAGG[T/G]AAGAAAAACAYACAAAAGACWGGYTYTACATTTCCTYTAGCTTAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 431 518 6 7
Genomic Location (Zv9):
Chromosome 13 (position 24277807)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23923467
KASP Assay ID:
554-4635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTACTGTAGGTGTGATCATTAAGAGGAAGAGTGGAGAAATCCCATG[T/A]CCCCTTGCTGTGGAGGCCTTCGCTGCACACCTGAGTTACATCTGCAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 452 518 6 7
Genomic Location (Zv9):
Chromosome 13 (position 24277870)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23923530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCCTTCGCTGCACACCTGAGTTACATCTGCAAATATGATGACAAGTA[C/A]AGCAAGTGAGTTTGACCAGGAATCAAAGCAAGAGTTCAGTCCCCTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link