fgfr1a

Ensembl ID:
ENSDARG00000011027
ZFIN ID:
ZDB-GENE-980526-255
Description:
Basic fibroblast growth factor receptor 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q90Z00]
Human Orthologue:
FGFR1
Human Description:
fibroblast growth factor receptor 1 [Source:HGNC Symbol;Acc:3688]
Mouse Orthologue:
Fgfr1
Mouse Description:
fibroblast growth factor receptor 1 Gene [Source:MGI Symbol;Acc:MGI:95522]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1689 Essential Splice Site Available for shipment Available now
sa21395 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3666 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21394 Nonsense Mutation detected in F1 DNA During 2014
sa12393 Essential Splice Site, Missense Available for shipment Available now
sa21393 Nonsense Mutation detected in F1 DNA During 2014
sa16812 Nonsense Available for shipment Available now
sa6106 Nonsense Mutation detected in F1 DNA During 2014
hu3264 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa1689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Essential Splice Site 34 809 1 17
ENSDART00000074774 Essential Splice Site 34 810 1 17
ENSDART00000127119 Essential Splice Site 46 328 1 16
ENSDART00000135166 Essential Splice Site 34 696 1 15
ENSDART00000147742 Essential Splice Site 34 808 1 17
Genomic Location:
Chromosome 8 (position 53785155)
KASP Assay ID:
554-1635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACTCAAGCTCTTCAGTCGCAGGGCAGACCAGCCATCCAAGATGAGGG[T/C]AAGTCTTTTCTCTGGTCCTCTTGTTCTGTTGTGTCAGAATTGAAGATTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Essential Splice Site 117 809 2 17
ENSDART00000074774 Essential Splice Site 117 810 2 17
ENSDART00000127119 Essential Splice Site 129 328 2 16
ENSDART00000135166 Essential Splice Site 117 696 2 15
ENSDART00000147742 Essential Splice Site 117 808 2 17
Genomic Location:
Chromosome 8 (position 53763968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGGACTCAACAGCAACCATACAGAATACTTCAATATCAGTGTTACAG[G/A]TGAGAATGCAACTGAATACACAATACATCACAAAATTATCATTATCGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 None None 809 None 17
ENSDART00000074774 Essential Splice Site 350 810 7 17
ENSDART00000127119 None None 328 None 16
ENSDART00000135166 None None 696 None 15
ENSDART00000147742 Essential Splice Site 350 808 7 17
Genomic Location:
Chromosome 8 (position 53732656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTATCGGCCACTCCCATCACTCTGCATGGTTGACTGTCTATAAAGG[T/C]ATCTTGTGGTGCTCTTTTTGGTTCATGGTTTTCTTCTGCCTGTCTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Nonsense 399 809 8 17
ENSDART00000074774 Nonsense 398 810 8 17
ENSDART00000127119 None None 328 7 16
ENSDART00000135166 None None 696 None 15
ENSDART00000147742 Nonsense 398 808 8 17
Genomic Location:
Chromosome 8 (position 53724032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGCTGGCCAAAATGCACAGCTCTGCCAAGAAAAGCGACTTCAACAGC[C/T]AGCTGGCCGTCCACAAGCTGGCCAAGAGCATCCCCCTGCGCAGACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Essential Splice Site 414 809 None 17
ENSDART00000074774 Missense 414 810 8 17
ENSDART00000127119 Essential Splice Site None 328 None 16
ENSDART00000135166 None None 696 None 15
ENSDART00000147742 Essential Splice Site 413 808 None 17
Genomic Location:
Chromosome 8 (position 53723983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTGGCYGTCCACAAGCTGGCCAAGAGCATCCCCCTGCGCAGACAGG[T/C]AACAGAAAGTAKATAGGGGGTTTGATATCTTTACTACTAAACACACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Nonsense 449 809 9 17
ENSDART00000074774 Nonsense 450 810 9 17
ENSDART00000127119 None None 328 8 16
ENSDART00000135166 Nonsense 336 696 7 15
ENSDART00000147742 Nonsense 448 808 9 17
Genomic Location:
Chromosome 8 (position 53721719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGTCTGTCCTCCAGTGGCTCCCCAATGCTCTCAGGGGTCTCCGAATA[C/A]GAGCTTCCCCAGGACCCACGCTGGGAGGTGCAACGAGACAGGTAACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Nonsense 461 809 9 17
ENSDART00000074774 Nonsense 462 810 9 17
ENSDART00000127119 None None 328 8 16
ENSDART00000135166 Nonsense 348 696 7 15
ENSDART00000147742 Nonsense 460 808 9 17
Genomic Location:
Chromosome 8 (position 53721685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGGTCTCCGAATACGAGCTKCCCCAGGACCCACGCTGGGAGGTGCAA[C/T]GAGACRGGTAACACACAACAAACTCCTTATTTACTGACAATATGKTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Nonsense 656 809 14 17
ENSDART00000074774 Nonsense 657 810 14 17
ENSDART00000127119 None None 328 13 16
ENSDART00000135166 Nonsense 543 696 12 15
ENSDART00000147742 Nonsense 655 808 14 17
Genomic Location:
Chromosome 8 (position 53715642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTTGTGTTTTTTTCAGGGTCGTTTGCCGGTGAAATGGATGGCTCCC[G/T]AAGCTCTGTTTGACCGCATWTACACCCATCARAGTGAYGTGTACGTSTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3264
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024882 Nonsense 670 809 15 17
ENSDART00000074774 Nonsense 671 810 15 17
ENSDART00000127119 None None 328 14 16
ENSDART00000135166 Nonsense 557 696 13 15
ENSDART00000147742 Nonsense 669 808 15 17
Genomic Location:
Chromosome 8 (position 53715513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGTGCTTTCATAAGTAATAACTCTTGTGTGTTGATGACCTCAGCTG[G/A]TCTTTTGGGGTGCTGCTGTGGGAGATCTTCACTCTGGGGGGCTCTCCGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j0d4gk9y