mios

Ensembl ID:
ENSDARG00000010995
ZFIN ID:
ZDB-GENE-040426-856
Description:
WD repeat-containing protein mio [Source:UniProtKB/Swiss-Prot;Acc:Q802U2]
Human Orthologue:
MIOS
Human Description:
missing oocyte, meiosis regulator, homolog (Drosophila) [Source:HGNC Symbol;Acc:21905]
Mouse Orthologue:
Mios
Mouse Description:
missing oocyte, meiosis regulator, homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2182066]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22946 Nonsense Mutation detected in F1 DNA During 2014
sa10252 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122724 Nonsense 93 876 2 11
Genomic Location:
Chromosome 16 (position 50507215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGTTAGCTGTGGGACATACCAATGGCCGAGTCGTGTTAACCAGTT[T/A]GGGACAGAGCCACAACTCCAAAAGTAAGGACCTCGCGGGTAAAGAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122724 Nonsense 267 876 2 11
Genomic Location:
Chromosome 16 (position 50506694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTTGGGATTTGCGCAAATTCGAAAAACCAGTTTTTACTTTAAACGAA[C/T]AGCCTAAACCTTTGACTAAAGTTGCATGGTGTCCTACTCGGATGGGTKTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xzo8jgs2