si:dkey-220h13.7

Ensembl ID:
ENSDARG00000010977
ZFIN ID:
ZDB-GENE-091118-61
Human Orthologue:
RAB34
Human Description:
RAB34, member RAS oncogene family [Source:HGNC Symbol;Acc:16519]
Mouse Orthologue:
Rab34
Mouse Description:
RAB34, member of RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:104606]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7306 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12037 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004740 Essential Splice Site 46 259 2 10
ENSDART00000141382 Essential Splice Site 47 254 3 11

The following transcripts of ENSDARG00000010977 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25464191)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26034009
KASP Assay ID:
554-4438.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCTTCAATATTACTGTTAGAGAGGCTTGTCAAGGGCAGAAAACAGGG[T/G]AAGTTATACTTGACACAGAAACGACAGTTTGTAATTTAGTTTTTAAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004740 Nonsense 149 259 7 10
ENSDART00000141382 Nonsense 144 254 8 11

The following transcripts of ENSDARG00000010977 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25460403)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26030221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAATCATGAATGGTGTTTGTTTTCTGTGTCTGTTTATTCAGAGAWTG[G/A]MTTGAAGATGCCATGAGGGACAATGACCCGTCCAGTGTCCTGCTCTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link