fkbp7

Ensembl ID:
ENSDARG00000010962
ZFIN ID:
ZDB-GENE-030616-182
Description:
FK506 binding protein 7 [Source:RefSeq peptide;Acc:NP_001004506]
Human Orthologue:
FKBP7
Human Description:
FK506 binding protein 7 [Source:HGNC Symbol;Acc:3723]
Mouse Orthologue:
Fkbp7
Mouse Description:
FK506 binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:1336879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5560 Nonsense Mutation detected in F1 DNA During 2014
sa7285 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019780 None None 219 None 4
ENSDART00000128737 Nonsense 130 272 3 6
ENSDART00000136728 None None 222 None 4
ENSDART00000019780 None None 219 None 4
ENSDART00000128737 Nonsense 130 272 3 6
ENSDART00000136728 None None 222 None 4

The following transcripts of ENSDARG00000010962 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 43802754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGGTTTCACCATATTAAATTTAAGACATTTTTAAGACTAAATTTA[C/T]AGATAAATGGGTAAATGCCAARGAATTTTTCAAATGCCCCAGATGGAMAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019780 None None 219 None 4
ENSDART00000128737 Nonsense 130 272 3 6
ENSDART00000136728 None None 222 None 4
ENSDART00000019780 None None 219 None 4
ENSDART00000128737 Nonsense 130 272 3 6
ENSDART00000136728 None None 222 None 4

The following transcripts of ENSDARG00000010962 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 43802754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGGTTTCACCATATTAAATKTAAGACATTTTTAAGACTAAATTTA[C/T]AGATAAATGGGTAAATGCCAARGAATTTTTCAAATGCCCCAGATGGAMAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jytvx91r