glmnb

Ensembl ID:
ENSDARG00000010958
ZFIN ID:
ZDB-GENE-080723-14
Description:
glomulin, FKBP associated protein b [Source:RefSeq peptide;Acc:NP_001124101]
Human Orthologue:
GLMN
Human Description:
glomulin, FKBP associated protein [Source:HGNC Symbol;Acc:14373]
Mouse Orthologue:
Glmn
Mouse Description:
glomulin, FKBP associated protein Gene [Source:MGI Symbol;Acc:MGI:2141180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12502 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014661 Essential Splice Site 91 585 4 18
Genomic Location:
Chromosome 6 (position 28689666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAAACACTACTGTGAAATGATGGCTTATCTAAGTTTACATTTTNTTGT[A/T]GATCTGCAGAGTGAAAGAAGTACTCAATACTTTACTTCAACAAGTGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h09a3zcc