mpp2b

Ensembl ID:
ENSDARG00000010957
ZFIN ID:
ZDB-GENE-040704-70
Description:
MAGUK p55 subfamily member 2 [Source:RefSeq peptide;Acc:NP_001002223]
Human Orthologue:
MPP2
Human Description:
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) [Source:HGNC Symbol;Acc:7220]
Mouse Orthologue:
Mpp2
Mouse Description:
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) Gene [Source:MGI Symbol;Acc:MGI:185

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14300 Essential Splice Site Available for shipment Available now
sa11363 Nonsense Available for shipment Available now
sa4454 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19029 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12920 Nonsense Available for shipment Available now
sa22043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009301 Essential Splice Site 11 547 2 13
ENSDART00000126428 Essential Splice Site 11 547 2 13
ENSDART00000134619 None None 247 None 7

The following transcripts of ENSDARG00000010957 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 11354374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACWCAAGAAAAYAAAAATGCCAGTGGCATCTGCCAGCTCTGACTCAGG[T/G]AAGATGCTTTATTTTAACGATTTACTGAACACAAGGTCTGTTAYCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009301 Nonsense 232 547 7 13
ENSDART00000126428 Nonsense 232 547 7 13
ENSDART00000134619 None None 247 None 7

The following transcripts of ENSDARG00000010957 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 11299179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTKGTCTGTTTTTGTTTGCAGGCYTTTGTAAAGTGTCACTTCGACTA[T/G]GACCCCTCTCATGACAACCTGATCCCCTGTAAAGAGGCTGGACTTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009301 Essential Splice Site 302 547 9 13
ENSDART00000126428 Essential Splice Site 302 547 9 13
ENSDART00000134619 None None 247 None 7
ENSDART00000009301 Essential Splice Site 302 547 9 13
ENSDART00000126428 Essential Splice Site 302 547 9 13
ENSDART00000134619 None None 247 None 7

The following transcripts of ENSDARG00000010957 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 11294720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGTCACACTGTGAGTGTATACTAGCAGGATGTGTGCTGATGTCCGC[A/T]GGGCCTCTGTGTGCAGGGATAGGCGGTAAGAAGAAGAAGAAGATGATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009301 Essential Splice Site 302 547 9 13
ENSDART00000126428 Essential Splice Site 302 547 9 13
ENSDART00000134619 None None 247 None 7
ENSDART00000009301 Essential Splice Site 302 547 9 13
ENSDART00000126428 Essential Splice Site 302 547 9 13
ENSDART00000134619 None None 247 None 7

The following transcripts of ENSDARG00000010957 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 11294720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGTCACACTGTGAGTGTATACTAGCAGGATGTGTGCTGATGTCCGC[A/T]GGGCCTCTGTGTGCAGGGATAGGCGGTAAGAAGAAGAAGAAGATGATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009301 Nonsense 385 547 11 13
ENSDART00000126428 Nonsense 385 547 11 13
ENSDART00000134619 Nonsense 130 247 5 7

The following transcripts of ENSDARG00000010957 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 11289444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAACSTKCCTCATTTGTTGCTGTGCACAGACACATCTCGTAAACCC[A/T]AGGTGGATGAGAARGAAGGGCAGATGTACCTGTTCATGTCCCGCAGYGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009301 Nonsense 494 547 13 13
ENSDART00000126428 Nonsense 494 547 13 13
ENSDART00000134619 Nonsense 239 247 7 7

The following transcripts of ENSDARG00000010957 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 11279215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGAGCGTTGATGATTTCTCTCTGATACTTCCCAGGATTCAGAACTG[A/T]AACGGACGGTGGACGAGAGCGAAAGGATCCAGAGGGCGTACAGTCACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bg3oqu6n