sh3glb1

Ensembl ID:
ENSDARG00000010956
ZFIN ID:
ZDB-GENE-030131-6851
Description:
SH3-domain GRB2-like endophilin B1 [Source:UniProtKB/TrEMBL;Acc:B0V151]
Human Orthologue:
SH3GLB1
Human Description:
SH3-domain GRB2-like endophilin B1 [Source:HGNC Symbol;Acc:10833]
Mouse Orthologue:
Sh3glb1
Mouse Description:
SH3-domain GRB2-like B1 (endophilin) Gene [Source:MGI Symbol;Acc:MGI:1859730]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39794 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31267 Nonsense Available for shipment Available now
sa39795 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045933 Essential Splice Site 156 360 None 9

The following transcripts of ENSDARG00000010956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16001950)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16512777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCACTCCTTTTAGGAACTTCATTGAGGGAGATTTTAAAACCATATTGG[T/C]GAGCATGCATTTTAATTCATTATATTATATTATATTATATTATATTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045933 Nonsense 248 360 7 9

The following transcripts of ENSDARG00000010956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16012040)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16522867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGCGTATTACGCCCAGTGTTACCAGTATACAGTCAATCTGCAGAAA[C/T]AGCTGGGCAGGTTGGCACCCTCATATCTTTATGCATTTTGTTGTGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045933 Essential Splice Site 251 360 7 9

The following transcripts of ENSDARG00000010956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16012051)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16522878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCCCAGTGTTACCAGTATACAGTCAATCTGCAGAAACAGCTGGGCAG[G/A]TTGGCACCCTCATATCTTTATGCATTTTGTTGTGATATCAATGTTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link