ndel1a

Ensembl ID:
ENSDARG00000010953
ZFIN ID:
ZDB-GENE-040115-2
Description:
Nuclear distribution protein nudE-like 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q7SXI6]
Human Orthologue:
NDEL1
Human Description:
nudE nuclear distribution gene E homolog (A. nidulans)-like 1 [Source:HGNC Symbol;Acc:17620]
Mouse Orthologue:
Ndel1
Mouse Description:
nuclear distribution gene E-like homolog 1 (A. nidulans) Gene [Source:MGI Symbol;Acc:MGI:1932915]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35305 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022495 Essential Splice Site 175 344 5 9
Genomic Location (Zv9):
Chromosome 12 (position 28049150)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26386759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAATCTCTCCTTGTGTCTGTGCAGAGACTAAAAGATGAAGCCAGAG[G/T]TATTTACTGACTCTGCTCTCAGTAATCTGGTCATGTGTAATTACAGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link