kif11

Ensembl ID:
ENSDARG00000010948
ZFIN ID:
ZDB-GENE-020426-1
Description:
kinesin-like protein KIF11 [Source:RefSeq peptide;Acc:NP_775368]
Human Orthologue:
KIF16B
Human Description:
kinesin family member 16B [Source:HGNC Symbol;Acc:15869]
Mouse Orthologue:
Kif16b
Mouse Description:
kinesin family member 16B Gene [Source:MGI Symbol;Acc:MGI:1098240]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15737 Essential Splice Site Available for shipment Available now
sa12364 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024194 Essential Splice Site 434 955 12 23
Genomic Location:
Chromosome 17 (position 19318683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACRGAGTACACTGAGCGSATWGCTGCTAYGGAGGAKGAGCTYAAAAAG[G/A]TGCGCATCTTTNNNNNNCMTTCTACTTCTGCTTTTCTTTTGGCAACTTCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024194 Nonsense 517 955 14 23
Genomic Location:
Chromosome 17 (position 19319139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGCTGAGGCCAGCACACAGGATGTYGGTGGTCTCCATGCTAAGCTA[C/T]AAAGGAAGAAGGATGTGGAGCTTCATAACAGTAAGGTTCAGGAGAGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ileal carcinoids: A pilot genome-wide association study shows genomic variants enriched in the non-tumor cells of patients with well-differentiated neuroendocrine tumors of the ileum. (View Study)
  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6x3jei4n