kif11

Ensembl ID:
ENSDARG00000010948
ZFIN ID:
ZDB-GENE-020426-1
Description:
kinesin-like protein KIF11 [Source:RefSeq peptide;Acc:NP_775368]
Human Orthologue:
KIF16B
Human Description:
kinesin family member 16B [Source:HGNC Symbol;Acc:15869]
Mouse Orthologue:
Kif16b
Mouse Description:
kinesin family member 16B Gene [Source:MGI Symbol;Acc:MGI:1098240]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15737 Essential Splice Site Available for shipment Available now
sa12364 Nonsense Available for shipment Available now
sa36376 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024194 Essential Splice Site 434 955 12 23
Genomic Location:
Chromosome 17 (position 19318683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACRGAGTACACTGAGCGSATWGCTGCTAYGGAGGAKGAGCTYAAAAAG[G/A]TGCGCATCTTTNNNNNNCMTTCTACTTCTGCTTTTCTTTTGGCAACTTCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024194 Nonsense 517 955 14 23
Genomic Location:
Chromosome 17 (position 19319139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGCTGAGGCCAGCACACAGGATGTYGGTGGTCTCCATGCTAAGCTA[C/T]AAAGGAAGAAGGATGTGGAGCTTCATAACAGTAAGGTTCAGGAGAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024194 Essential Splice Site None 955 22 23
Genomic Location:
Chromosome 17 (position 19326614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGAGAACCTGATATGTTATGAGAATGGAAGGATTCCTTTTTTCAAG[G/A]TAAGAAATTGTAAACATTTTTAATTTTTAAGAAATGATCATAATAGTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ileal carcinoids: A pilot genome-wide association study shows genomic variants enriched in the non-tumor cells of patients with well-differentiated neuroendocrine tumors of the ileum. (View Study)
  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link