cbsb

Ensembl ID:
ENSDARG00000010946
ZFIN ID:
ZDB-GENE-021030-3
Description:
cystathionine-beta-synthase b [Source:RefSeq peptide;Acc:NP_001014367]
Human Orthologue:
CBS
Human Description:
cystathionine-beta-synthase [Source:HGNC Symbol;Acc:1550]
Mouse Orthologue:
Cbs
Mouse Description:
cystathionine beta-synthase Gene [Source:MGI Symbol;Acc:MGI:88285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27348 Nonsense Mutation detected in F1 DNA During 2017
sa38725 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026275 Nonsense 116 597 3 16
ENSDART00000121665 Nonsense 116 597 3 15
Genomic Location (Zv9):
Chromosome 9 (position 9443335)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9243886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCTTTTTCTCACAGGACAAAGACGTCCGGTATCCTCCCCAACATCT[T/A]AAGCAAGATTGGAGAGACCCCAATGGTTCGCATGAACAAGATTCCCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026275 Essential Splice Site 312 597 8 16
ENSDART00000121665 Essential Splice Site 312 597 8 15
Genomic Location (Zv9):
Chromosome 9 (position 9427637)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9228188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTGCTTTGCATTATTAATGAGATTTTTAATTTCTTTTTTTATTCTTC[A/C]GATCATTGGAGTGGATCCGGAGGGCTCTATTCTAGCTGAGCCAGACGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Homocysteine levels: Novel associations of CPS1, MUT, NOX4, and DPEP1 with plasma homocysteine in a healthy population: a genome-wide evaluation of 13 974 participants in the Women's Genome Health Study. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link