RAPGEF6

Ensembl ID:
ENSDARG00000010945
Description:
Rap guanine nucleotide exchange factor (GEF) 6 [Source:HGNC Symbol;Acc:20655]
Human Orthologue:
RAPGEF6
Human Description:
Rap guanine nucleotide exchange factor (GEF) 6 [Source:HGNC Symbol;Acc:20655]
Mouse Orthologue:
Rapgef6
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI Symbol;Acc:MGI:2384761]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8486 Nonsense Mutation detected in F1 DNA During 2016
sa43729 Nonsense Mutation detected in F1 DNA During 2016
sa43730 Nonsense Mutation detected in F1 DNA During 2016
sa14914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063714 Nonsense 208 1334 5 28
Genomic Location:
Chromosome 21 (position 43775185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTCTCTCTCACACTCTGCTGTCGTGTGTGCAGTTCGTGTGTATCGCG[C/T]AGCAGGATTACTGCCGCATCCTCAATCATGTGGAGCAGAACACACACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063714 Nonsense 298 1334 6 28
Genomic Location:
Chromosome 21 (position 43778020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACCGCACCTTCCTGTCCAGCCCCATGGAGGTGGGAAACAAGCTTCTG[G/T]AGTGGTTCAGAGTCGACGCTCTGAGAGACACGGTCAGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063714 Nonsense 679 1334 16 28
Genomic Location:
Chromosome 21 (position 43783863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCGCTCAGGTACTACCTGAAGAACAACATGGAGACGGAGACGCTGTG[T/A]TCAGACGAGGACGCTCAGGATCTGCTGCGGGAGAGTCAGATCAGCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063714 Essential Splice Site 1095 1334 23 28
Genomic Location:
Chromosome 21 (position 43795240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTAGAAGCGCGAGTRAAAGCAGCATGTTGAACTGTTTTCTGTCTGC[A/T]GGTTACGCCYTGATGCCCGCGGGTCGCTCTGATCTGTCAGACTCCAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link