RAPGEF6

Ensembl ID:
ENSDARG00000010945
Description:
Rap guanine nucleotide exchange factor (GEF) 6 [Source:HGNC Symbol;Acc:20655]
Human Orthologue:
RAPGEF6
Human Description:
Rap guanine nucleotide exchange factor (GEF) 6 [Source:HGNC Symbol;Acc:20655]
Mouse Orthologue:
Rapgef6
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI Symbol;Acc:MGI:2384761]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8486 Nonsense Mutation detected in F1 DNA During 2014
sa14914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063714 Nonsense 208 1334 5 28
Genomic Location:
Chromosome 21 (position 43775185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTCTCTCTCACACTCTGCTGTCGTGTGTGCAGTTCGTGTGTATCGCG[C/T]AGCAGGATTACTGCCGCATCCTCAATCATGTGGAGCAGAACACACACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063714 Essential Splice Site 1095 1334 23 28
Genomic Location:
Chromosome 21 (position 43795240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTAGAAGCGCGAGTRAAAGCAGCATGTTGAACTGTTTTCTGTCTGC[A/T]GGTTACGCCYTGATGCCCGCGGGTCGCTCTGATCTGTCAGACTCCAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b1jen2wk