abcb4

Ensembl ID:
ENSDARG00000010936
ZFIN ID:
ZDB-GENE-080204-52
Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 4 [Source:RefSeq peptide;Acc:NP_001108055]
Human Orthologues:
ABCB1, ABCB4
Human Descriptions:
ATP-binding cassette, sub-family B (MDR/TAP), member 1 [Source:HGNC Symbol;Acc:40]
ATP-binding cassette, sub-family B (MDR/TAP), member 4 [Source:HGNC Symbol;Acc:45]
Mouse Orthologues:
Abcb1a, Abcb1b, Abcb4
Mouse Descriptions:
ATP-binding cassette, sub-family B (MDR/TAP), member 1A Gene [Source:MGI Symbol;Acc:MGI:97570]
ATP-binding cassette, sub-family B (MDR/TAP), member 1B Gene [Source:MGI Symbol;Acc:MGI:97568]
ATP-binding cassette, sub-family B (MDR/TAP), member 4 Gene [Source:MGI Symbol;Acc:MGI:97569]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16234 Nonsense Available for shipment Available now
sa25016 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9671 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019720 Nonsense 217 650 7 15
ENSDART00000035873 Nonsense 217 1275 6 27
Genomic Location:
Chromosome 16 (position 30883939)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTCACTACTTTTATTGTTGGCATTATCATTGGCTTTGCTAAAGGCTG[G/A]AAGCTGACCCTCGTCATYCTCGCTGTTAGCCCGYTACTCGGWATCTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019720 Essential Splice Site 580 650 14 15
ENSDART00000035873 Essential Splice Site 580 1275 13 27
Genomic Location:
Chromosome 16 (position 30877928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCCTGGATGCAGAGAGTGAGACTATTGTGCAAGCAGCTCTAGATAAG[G/A]TAACAAAGAATATTTTTCTGTGTTCATTTTTCTATACTATATATATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019720 None None 650 None 15
ENSDART00000035873 Essential Splice Site 1210 1275 26 27
Genomic Location:
Chromosome 16 (position 30860712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCTGCTGGATGAAGCCACGTCTGCKCTGGACACAGAGAGCGAGAAG[G/A]TACAGCATAAGCACCGTTCACACACTACTGACGTTCTGGTNAAAAAAANN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0fbjkvv6