si:ch73-289n4.1

Ensembl ID:
ENSDARG00000010933
ZFIN ID:
ZDB-GENE-091204-7
Human Orthologue:
CACNA1F
Human Description:
calcium channel, voltage-dependent, L type, alpha 1F subunit [Source:HGNC Symbol;Acc:1393]
Mouse Orthologue:
Cacna1f
Mouse Description:
calcium channel, voltage-dependent, alpha 1F subunit Gene [Source:MGI Symbol;Acc:MGI:1859639]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31671 Nonsense Available for shipment Available now
sa13270 Splice Site, Nonsense Available for shipment Available now
sa14651 Nonsense Available for shipment Available now
sa21366 Splice Site, Nonsense Available for shipment Available now
sa38708 Nonsense Mutation detected in F1 DNA During 2017
sa7156 Nonsense Mutation detected in F1 DNA During 2017
sa34474 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21367 Nonsense Available for shipment Available now
sa34475 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa1321 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Nonsense 364 1914 8 57
ENSDART00000142712 Nonsense 324 659 7 15
Genomic Location (Zv9):
Chromosome 8 (position 46678445)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44867424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATGGAGGAGGACATGATCGGCTACATGGACTGGCTCATTGAAGCT[G/T]AGGATATGGATGAAGATGGAAATAAGCGTAATATAAACTTTATTTCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Splice Site, Nonsense 456 1914 16 57
ENSDART00000142712 Splice Site 377 659 10 15
Genomic Location (Zv9):
Chromosome 8 (position 46682246)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44863623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTGCACATTTTACWCTTGCAAYTGTTAATTATTGTTCTCATCCTCAG[T/A]GAGYAACTGTACCACTTRAATGTAGTTATGAGGAWGAACTGTCGGGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Nonsense 458 1914 16 57
ENSDART00000142712 Nonsense 379 659 10 15
Genomic Location (Zv9):
Chromosome 8 (position 46682250)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44863619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACATTTTACWCTTGCAAYTGTTAATTATTGTTCTCATCCTCAGWGAG[C/T]AACTGTACCACTTRAATGTAGTTATGAGGAWGAACTGTCGGGTTGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Splice Site, Nonsense 511 1914 17 57
ENSDART00000142712 Splice Site, Nonsense 432 659 11 15
Genomic Location (Zv9):
Chromosome 8 (position 46682498)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44863371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGAACATAATGACCATGTTTTAAATGTTGTCTCTCTATTGTGTCAGAA[C/T]GAGCAAATAAGATCCTTCTGGCTCTGTTTACGCTGGAGATGCTGATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Nonsense 652 1914 18 57
ENSDART00000142712 Nonsense 573 659 12 15
Genomic Location (Zv9):
Chromosome 8 (position 46685254)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44860615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATGAAAAGAAGCACCTTCGACTCTTTTCCATCTGCCTTACTCACCTG[T/A]TTCCAGGTAATTTCATCCGTCTCTAAGCAGTGTTACAATTTACGTAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Nonsense 762 1914 23 57
ENSDART00000142712   None 659 None 15
Genomic Location (Zv9):
Chromosome 8 (position 46689583)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44856286
KASP Assay ID:
554-4651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACATATTTMTKCTTGTTCAGAATGARATGGATGATTGGGAAGAGAAT[G/T]AAGAGCTRAGAGCAATYGAAGGGCTTGAGGGTAAATTCTTWMCACTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Essential Splice Site 1156 1914 33 57
ENSDART00000142712   None 659 None 15
Genomic Location (Zv9):
Chromosome 8 (position 46702469)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44843795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCATGTTTGTCCTCATTCTGCTCAACACACTCACGTTGGCTGTACAG[G/A]TACACACACATACACATTTAAGCATGCTATAATTTCAATGTCCTACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Nonsense 1195 1914 35 57
ENSDART00000142712   None 659 None 15
Genomic Location (Zv9):
Chromosome 8 (position 46702804)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44843460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTCTCCTTTTGCTCTCAACATCTTTGTCTTGGATTTGACAGCATTA[T/A]TTTATAGATGCCTGGAATTCTTTTGATGCACTGATAGTGGTGGGCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Splice Site, Nonsense 1521 1914 44 57
ENSDART00000142712   None 659 None 15
Genomic Location (Zv9):
Chromosome 8 (position 46712357)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44834542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAACGCACCAAACCCAAACTCCTAGATGAAGTTATACCTCCCCCTT[C/A]AGGTACAGTTTGCTAAGATTTTTTCTAGTAGACTTTATGTTTTGAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011078 Nonsense 1874 1914 57 57
ENSDART00000142712   None 659 None 15
Genomic Location (Zv9):
Chromosome 8 (position 46736911)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44809884
KASP Assay ID:
554-1235.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCGCAAATTTGTTGACTTCGCAAAACGGGAGATTGCAGATGCCTGT[C/T]AAATGACTGTTGATGAAATGGAGAACGCCGCAACTGACCTTTTATGTAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link