HTRA3 (1 of 2)

Ensembl ID:
ENSDARG00000010925
Description:
HtrA serine peptidase 3 [Source:HGNC Symbol;Acc:30406]
Human Orthologue:
HTRA3
Human Description:
HtrA serine peptidase 3 [Source:HGNC Symbol;Acc:30406]
Mouse Orthologue:
Htra3
Mouse Description:
HtrA serine peptidase 3 Gene [Source:MGI Symbol;Acc:MGI:1925808]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7331 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023770 Essential Splice Site 152 465 3 11
Genomic Location (Zv9):
Chromosome 7 (position 62482044)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61529242
KASP Assay ID:
554-4470.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCATGCCAAAACGAGGACATTTTTTTTTTACTAGATGGAAGTTCATT[G/T]TCCTTTTTTTTTTTTTTTNNNNNNTTTTGTGATGTGCATCCAMTTAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link