si:ch211-5k11.11

Ensembl ID:
ENSDARG00000010918
ZFIN ID:
ZDB-GENE-030131-1348
Description:
alpha globin regulatory element containing-like [Source:RefSeq peptide;Acc:NP_001020705]
Human Orthologue:
NPRL3
Human Description:
nitrogen permease regulator-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:14124]
Mouse Orthologue:
Nprl3
Mouse Description:
nitrogen permease regulator-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:109258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6921 Nonsense Mutation detected in F1 DNA During 2017
sa20152 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038575 Nonsense 112 581 3 13
ENSDART00000126332 Nonsense 150 619 5 15
ENSDART00000144457   None 61 2 5
Genomic Location (Zv9):
Chromosome 3 (position 55922582)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54816308
KASP Assay ID:
554-4748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAACTAAAAATAGACAATGTGCGATTCGTTGGRCATCCAACYTTACTR[C/T]AGCCTCCTCWTACTATTCAGGTAAGACAAGACATAWACCATTACTTSTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038575 Nonsense 142 581 4 13
ENSDART00000126332 Nonsense 180 619 6 15
ENSDART00000144457   None 61 3 5
Genomic Location (Zv9):
Chromosome 3 (position 55920158)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54813884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAAAAGAGAGCTGCCCACCATGATTCTGTTCAGTGTTGTTTTTGCAT[T/A]ACGGGTAAGAAAACAATAAATGAATGTGTCAGAAAGACCCATTAAATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link