churc1

Ensembl ID:
ENSDARG00000010831
ZFIN ID:
ZDB-GENE-041001-150
Description:
Protein Churchill [Source:UniProtKB/Swiss-Prot;Acc:Q5U3N7]
Human Orthologue:
FNTB
Human Description:
farnesyltransferase, CAAX box, beta [Source:HGNC Symbol;Acc:3785]
Mouse Orthologue:
Churc1
Mouse Description:
churchill domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923684]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5951 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005590 Nonsense 9 112 1 4
Genomic Location:
Chromosome 20 (position 25963975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTTTTACATCTGTCTGATCAGAAATGTGTACCGGTTGTGTCCAGAAG[C/T]AATATCCCGACAGGGTGAGTTATGATCATCTGTGACTGCAACAACTCAKG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/engfi29j