tfeb

Ensembl ID:
ENSDARG00000010794
ZFIN ID:
ZDB-GENE-090807-3
Human Orthologue:
TFEB
Human Description:
transcription factor EB [Source:HGNC Symbol;Acc:11753]
Mouse Orthologue:
Tcfeb
Mouse Description:
transcription factor EB Gene [Source:MGI Symbol;Acc:MGI:103270]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16652 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006580 Essential Splice Site 67 491 1 8
Genomic Location:
Chromosome 11 (position 23145132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAACACACTTCCAGGGACCCATGCAGGTGCCTGTTGAAGTGCTAAAGG[T/C]AGGTGTATCCATCAGCCTGTGTATCTGGGTTTGACTTAAAGCATATTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a4ywk1hm