cdc25

Ensembl ID:
ENSDARG00000010792
ZFIN ID:
ZDB-GENE-000330-5
Description:
cdc25 [Source:RefSeq peptide;Acc:NP_001108567]
Human Orthologues:
CDC25A, CDC25B
Human Descriptions:
cell division cycle 25 homolog A (S. pombe) [Source:HGNC Symbol;Acc:1725]
cell division cycle 25 homolog B (S. pombe) [Source:HGNC Symbol;Acc:1726]
Mouse Orthologues:
Cdc25a, Cdc25b
Mouse Descriptions:
cell division cycle 25 homolog A (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:103198]
cell division cycle 25 homolog B (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:99701]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42163 Nonsense Mutation detected in F1 DNA During 2017
sa42162 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020576 Nonsense 84 563 2 15
ENSDART00000082393 Nonsense 84 562 2 17
ENSDART00000142785   None 122 None 6
Genomic Location (Zv9):
Chromosome 13 (position 14789389)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14797384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCGTTTTGATGCAGTCAATGTGAAACTCCAAAGCGGAAGAAAAATT[T/A]GCCCCTCCTGAAGATTCCTTCCTTCGCCTCTGATGCCTCTTCTGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020576 Nonsense 287 563 9 15
ENSDART00000082393 Nonsense 286 562 11 17
ENSDART00000142785   None 122 None 6
Genomic Location (Zv9):
Chromosome 13 (position 14782658)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14790653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAATGGACAGTCTTCTAACTGCTCCTCTGGTGGCCAAGCAAATTCCT[G/T]AAACTGATTCGGTATGTTGTTAAATTGATTTATTTCTAATTTTTTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link