dla

Ensembl ID:
ENSDARG00000010791
ZFIN ID:
ZDB-GENE-980526-29
Description:
Delta-like protein A [Source:UniProtKB/Swiss-Prot;Acc:Q6DI48]
Human Orthologue:
DLL1
Human Description:
delta-like 1 (Drosophila) [Source:HGNC Symbol;Acc:2908]
Mouse Orthologue:
Dll1
Mouse Description:
delta-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104659]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19611 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006180 Essential Splice Site 262 800 5 13
ENSDART00000012104 Essential Splice Site 225 772 4 11
ENSDART00000126339 Essential Splice Site 225 763 4 12
Genomic Location (Zv9):
Chromosome 1 (position 54581544)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53355047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAAATCATCTGCGATGCTGGGTGGAAAGGCCAATACTGCACAGAAC[G/A]TGAGTACTTATATTTAATATAACAATCATTGCATATTAAAGGGATAGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link