thbs1

Ensembl ID:
ENSDARG00000010785
ZFIN ID:
ZDB-GENE-020708-1
Description:
Novel protein similar to vertebrate thrombospondin 1 [Source:UniProtKB/TrEMBL;Acc:Q5SPG5]
Human Orthologue:
THBS1
Human Description:
thrombospondin 1 [Source:HGNC Symbol;Acc:11785]
Mouse Orthologue:
Thbs1
Mouse Description:
thrombospondin 1 Gene [Source:MGI Symbol;Acc:MGI:98737]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017090 Nonsense 576 1173 11 21
ENSDART00000140350 Nonsense 515 1112 11 22
Genomic Location:
Chromosome 20 (position 29072272)
KASP Assay ID:
554-1134.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTGAAGGGGCCCAGTGCACAAGCTTTCCAGATGGGTCCTGGAAATGT[G/T]GAAAATGCCCCACAGGATACACTGGCAATGGAATCAACTGCAAAGATGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4cuyopir