ppp1r12a

Ensembl ID:
ENSDARG00000010784
ZFIN ID:
ZDB-GENE-041011-3
Description:
Protein phosphatase 1 regulatory subunit 12A [Source:UniProtKB/Swiss-Prot;Acc:Q6DRG7]
Human Orthologue:
PPP1R12A
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 12A [Source:HGNC Symbol;Acc:7618]
Mouse Orthologue:
Ppp1r12a
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 12A Gene [Source:MGI Symbol;Acc:MGI:1309528]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20272 Essential Splice Site Available for shipment Available now
sa25279 Nonsense Mutation detected in F1 DNA During 2017
sa15933 Nonsense Available for shipment Available now
sa20271 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008940 Essential Splice Site 521 1049 11 26
ENSDART00000033825 Essential Splice Site 521 1030 11 28
ENSDART00000123424 Essential Splice Site 521 623 11 13
ENSDART00000132923 Essential Splice Site 589 1117 11 26
Genomic Location (Zv9):
Chromosome 4 (position 20453608)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21796943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCGAGGAGACATGTTAGCACCTCAGACATCGATGAGAAGGAAAACAGG[T/C]AAAGAGAGCTTTGTGTTGTTAAGAGCGCCTCCTGCTGCTCTGTGGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008940 Nonsense 708 1049 16 26
ENSDART00000033825 Nonsense 708 1030 17 28
ENSDART00000123424   None 623 None 13
ENSDART00000132923 Nonsense 776 1117 16 26
Genomic Location (Zv9):
Chromosome 4 (position 20445840)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21789175
KASP Assay ID:
554-7423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGTGTGTGTAGATCGTACCTCACTCCAGTACGAGATGAAGAATCT[G/T]AGTCTCAGAGGAAAGCCAGATCCAGACAGGCACGACAGTCCAGGAGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008940 Nonsense 720 1049 16 26
ENSDART00000033825 Nonsense 720 1030 17 28
ENSDART00000123424   None 623 None 13
ENSDART00000132923 Nonsense 788 1117 16 26
Genomic Location (Zv9):
Chromosome 4 (position 20445804)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21789139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATGAAGAATCTGAGTCTCAGAGGAAAGCCAGATCCAGACAGGCACGA[C/T]AGTCCAGGAGATCYACACAGGCAAGTCWAGACRCTCATCTAATAATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008940 Essential Splice Site 1021 1049 25 26
ENSDART00000033825 Essential Splice Site 1002 1030 27 28
ENSDART00000123424   None 623 None 13
ENSDART00000132923 Essential Splice Site 1089 1117 25 26
Genomic Location (Zv9):
Chromosome 4 (position 20432096)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21775431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAGCTCTAGAAAGGAAGATCTCTGAGATGGAGGAGGAGCTGAAGG[T/A]AATTATGTTCTGCCCTTTGCTGTGCGTGTGGGTCACCATTATAAAACCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link