scn1a

Ensembl ID:
ENSDARG00000010783
ZFIN ID:
ZDB-GENE-040426-751
Description:
sodium channel, voltage-gated, type I, alpha [Source:RefSeq peptide;Acc:NP_956426]
Human Orthologues:
SCN1A, SCN2A, SCN3A, SCN9A
Human Descriptions:
sodium channel, voltage-gated, type I, alpha subunit [Source:HGNC Symbol;Acc:10585]
sodium channel, voltage-gated, type II, alpha subunit [Source:HGNC Symbol;Acc:10588]
sodium channel, voltage-gated, type III, alpha subunit [Source:HGNC Symbol;Acc:10590]
sodium channel, voltage-gated, type IX, alpha subunit [Source:HGNC Symbol;Acc:10597]
Mouse Orthologues:
Scn1a, Scn2a1, Scn3a, Scn9a
Mouse Descriptions:
sodium channel, voltage-gated, type I, alpha Gene [Source:MGI Symbol;Acc:MGI:98246]
sodium channel, voltage-gated, type II, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:98248]
sodium channel, voltage-gated, type III, alpha Gene [Source:MGI Symbol;Acc:MGI:98249]
sodium channel, voltage-gated, type IX, alpha Gene [Source:MGI Symbol;Acc:MGI:107636]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21602 Essential Splice Site, Missense Available for shipment Available now
sa1674 Essential Splice Site, Missense Available for shipment Available now
sa41553 Nonsense Mutation detected in F1 DNA During 2017
sa15331 Nonsense Available for shipment Available now
sa7636 Missense Mutation detected in F1 DNA During 2017
sa21603 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011718 Essential Splice Site 649 1955 12 27
ENSDART00000090963 Missense 650 711 11 11
ENSDART00000090979 Essential Splice Site 650 1956 11 26
ENSDART00000128570 Essential Splice Site 649 1955 11 26
ENSDART00000011718 Essential Splice Site 649 1955 None 27
ENSDART00000090963 Missense 650 711 11 11
ENSDART00000090979 Essential Splice Site 650 1956 None 26
ENSDART00000128570 Essential Splice Site 649 1955 None 26

The following transcripts of ENSDARG00000010783 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 50926059)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50255166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATACACCAGAAGTTTCCCGAAAAAGAGCCATGTTTGACGACACTTGTG[T/A]AAGGACTCGTCTGATCTCGCATGGCATGAGACACTGTGCATGTTCCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011718 Essential Splice Site 649 1955 12 27
ENSDART00000090963 Missense 650 711 11 11
ENSDART00000090979 Essential Splice Site 650 1956 11 26
ENSDART00000128570 Essential Splice Site 649 1955 11 26
ENSDART00000011718 Essential Splice Site 649 1955 None 27
ENSDART00000090963 Missense 650 711 11 11
ENSDART00000090979 Essential Splice Site 650 1956 None 26
ENSDART00000128570 Essential Splice Site 649 1955 None 26

The following transcripts of ENSDARG00000010783 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 50926059)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50255166
KASP Assay ID:
554-1620.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACRCCAGAAGTTTCCCGAAAAAGAGCCATGTTTGACGACACTTGTG[T/C]AAGGACTCGTCTGATCTCGCATGGCATGAGACACTGTGCATGTTCCCTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011718 Nonsense 678 1955 13 27
ENSDART00000090963   None 711 None 11
ENSDART00000090979 Nonsense 679 1956 12 26
ENSDART00000128570 Nonsense 678 1955 12 26

The following transcripts of ENSDARG00000010783 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 50931492)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50249733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAGAACTTTTCGAAGGCTTATCGGCAGTCTATGAGAGAGAGAGCTT[T/A]GAGTGTAGCAAGTGGCAGCAACAACCCTGCTGAATGTAAGAAGCCATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011718 Nonsense 702 1955 14 27
ENSDART00000090963   None 711 None 11
ENSDART00000090979 Nonsense 703 1956 13 26
ENSDART00000128570 Nonsense 702 1955 13 26

The following transcripts of ENSDARG00000010783 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 50934337)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50246888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGYATGTCAGGTTCAGAGATCTTTAAACAGAGGTGTGAGGAGTGGTG[G/A]TTCGAGTTTGCGGAGAATTATTTGATCTGGGATTGCAGTCCCACATGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011718 Missense 839 1955 16 27
ENSDART00000090963   None 711 None 11
ENSDART00000090979 Missense 840 1956 15 26
ENSDART00000128570 Missense 839 1955 15 26

The following transcripts of ENSDARG00000010783 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 50936374)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50244851
KASP Assay ID:
554-4362.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTATTATTGTCTTACAGCTKAGGGTCTTTAAACTAGCGAAGTCGTGG[C/T]CAACGCTGAACATGCTTATCAAGATCATCGGGAACTCTYTGGGCGCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011718 Essential Splice Site 1088 1955 17 27
ENSDART00000090963   None 711 None 11
ENSDART00000090979 Essential Splice Site 1089 1956 16 26
ENSDART00000128570 Essential Splice Site 1088 1955 16 26

The following transcripts of ENSDARG00000010783 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 50939643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGAGGATTTCAGCAGCCTTTCTTCAGACCTAGAGGAGGATAAAGAGG[T/C]ACGTTTGAGTTTTTTAATAACTTCTAGACCAGGGATGTCAAACTCAATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Dental caries: Genome-wide association scan of dental caries in the permanent dentition. (View Study)
  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link