tlk2

Ensembl ID:
ENSDARG00000010779
ZFIN ID:
ZDB-GENE-060623-36
Description:
Serine/threonine-protein kinase tousled-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q1ECX4]
Human Orthologue:
TLK2
Human Description:
tousled-like kinase 2 [Source:HGNC Symbol;Acc:11842]
Mouse Orthologue:
Tlk2
Mouse Description:
tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI Symbol;Acc:MGI:1346023]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14440 Nonsense Available for shipment Available now
sa18506 Nonsense Available for shipment Available now
sa10364 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006490 Nonsense 124 697 7 21
ENSDART00000141937 Nonsense 124 697 6 20
Genomic Location:
Chromosome 3 (position 19584931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRTTGATGGTAAATAGAAATGTTTGTTTTGGTTTTGATTGACAGGWGCAG[C/T]AAGGAAGCCCCTCCTCCATCAGTTCAGTAAACACAGAYCACTCCCACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006490 Nonsense 441 697 16 21
ENSDART00000141937 Nonsense 441 697 15 20
ENSDART00000006490 Nonsense 441 697 16 21
ENSDART00000141937 Nonsense 441 697 15 20
Genomic Location:
Chromosome 3 (position 19597290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACTAAAATGTTTCTTGACATGTTTTTAGGCATGCCTGTCGAGAATA[T/A]AGAATCCAKAAAGAGCTGGACCATCCCAGAATAGTCAAAYTGTATGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006490 Nonsense 441 697 16 21
ENSDART00000141937 Nonsense 441 697 15 20
ENSDART00000006490 Nonsense 441 697 16 21
ENSDART00000141937 Nonsense 441 697 15 20
Genomic Location:
Chromosome 3 (position 19597290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACTAAAATGTTTCTTGACATGTTTTTAGGCATGCCTGTCGAGAATA[T/A]AGAATCCATAAAGAGCTGGACCATCCCAGAATAGTCAAAYTGTATGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yajtkre5