pnpla6

Ensembl ID:
ENSDARG00000010773
ZFIN ID:
ZDB-GENE-050107-4
Description:
Novel protein similar to H.sapiens PNPLA6, patatin-like phospholipase domain containing 6 (PNPLA6) [
Human Orthologue:
PNPLA6
Human Description:
patatin-like phospholipase domain containing 6 [Source:HGNC Symbol;Acc:16268]
Mouse Orthologue:
Pnpla6
Mouse Description:
patatin-like phospholipase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1354723]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32741 Nonsense Mutation detected in F1 DNA During 2017
sa14069 Nonsense Available for shipment Available now
sa17978 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049716 Nonsense 454 1342 13 34
ENSDART00000139219   None 820 None 19
ENSDART00000140890   None 355 None 11
ENSDART00000144735   None 213 None 6
Genomic Location (Zv9):
Chromosome 1 (position 46368367)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45205879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATCCTGAGGAGGAATCAGGGATGGACATTTTTAGCTCATTTCAAGGA[C/T]GACCAAACGCTACAGTGTTCGAGGAGGCCCAGAAGGAGATCCTCAGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049716 Nonsense 901 1342 22 34
ENSDART00000139219 Nonsense 427 820 9 19
ENSDART00000140890   None 355 None 11
ENSDART00000144735 Nonsense 38 213 1 6
Genomic Location (Zv9):
Chromosome 1 (position 46360402)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45197914
KASP Assay ID:
2259-0982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCTCTGGACACCTTCACCYGAAGTGTCCTCGTAGAGTCTTCTCACGA[A/T]GAAGCCCYACCAAACTGGTAAGAAAAATCACACAAATCCATCAGTGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049716 Nonsense 1005 1342 25 34
ENSDART00000139219 Nonsense 531 820 12 19
ENSDART00000140890   None 355 None 11
ENSDART00000144735 Nonsense 142 213 4 6
Genomic Location (Zv9):
Chromosome 1 (position 46359549)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45197061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTTATYAAAGCTATTTCTCTTGCCTGCAGGCTATGAACTCGGTGTTY[A/T]AAACAGTTCTGGATCTTACTTATCCAATCACRTCCATGTTCTCGGGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link