gipc1

Ensembl ID:
ENSDARG00000010771
ZFIN ID:
ZDB-GENE-060726-1
Description:
PDZ domain-containing protein GIPC1 [Source:RefSeq peptide;Acc:NP_001004018]
Human Orthologue:
GIPC1
Human Description:
GIPC PDZ domain containing family, member 1 [Source:HGNC Symbol;Acc:1226]
Mouse Orthologue:
Gipc1
Mouse Description:
GIPC PDZ domain containing family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1926252]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40158 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016973 Nonsense 308 335 6 6
ENSDART00000138481 Nonsense 308 335 7 7
Genomic Location (Zv9):
Chromosome 3 (position 50286358)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44980778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTGGCAAGGATAAAAAGAACCCAGATGAGTTTGCTGAAGCTTTGGAC[G/T]AGACTCTGGGCGATTTTGCTTTTCCAGATGAGTTTGTGTTTGATGTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link