epha4l

Ensembl ID:
ENSDARG00000010767
ZFIN ID:
ZDB-GENE-990415-61
Description:
Ephrin receptor [Source:UniProtKB/TrEMBL;Acc:O73879]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28531 Essential Splice Site Mutation detected in F1 DNA During 2015
sa22720 Nonsense Mutation detected in F1 DNA During 2015
sa15788 Nonsense Available for shipment Available now
sa22719 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa28531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004338 Essential Splice Site 33 988 1 17
Genomic Location:
Chromosome 15 (position 40564924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTTGTGCAGGTCTGTCCGCTCCGAGGAGTCCTCCGGCGAATGAAGG[T/C]AAGAGTGCTTTGAATAAATTGGAAAAGTTTAGGAGTTAAGTTAAACTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004338 Nonsense 489 988 7 17
Genomic Location:
Chromosome 15 (position 40502933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGTCTTCCGGACTCTGTTGTATTTCAGGATCAGAATGAGCGGAGTTA[T/A]CGTATTGTGAAGACGACTTCTCGAAATGCTGATATTAAGGATCTGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004338 Nonsense 497 988 7 17
Genomic Location:
Chromosome 15 (position 40502911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTCAGGATCAGAATGAGCGGAGYTATCGTATTGTRAAGACGACTTCT[C/T]GAAATGCTGATATTAAGGATCTGACCCCGCTGACCTCATACGTGTTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004338 Essential Splice Site 951 988 16 17
Genomic Location:
Chromosome 15 (position 40476894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCGCAGGCTACAGCAGCATAGAGAGCGTAATACCCATGAATCACGAG[T/A]GAGCATCACATTACACAACAACAACACACCTGTAATCACACACCCCCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain imaging: Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: A study of the ADNI cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ucdgu5a9