si:ch211-160d20.1

Ensembl ID:
ENSDARG00000010758
ZFIN ID:
ZDB-GENE-050419-245
Description:
hypothetical protein LOC799247 [Source:RefSeq peptide;Acc:NP_001076532]
Human Orthologues:
CAPN5, CAPN6
Human Descriptions:
calpain 5 [Source:HGNC Symbol;Acc:1482]
calpain 6 [Source:HGNC Symbol;Acc:1483]
Mouse Orthologues:
Capn5, Capn6
Mouse Descriptions:
calpain 5 Gene [Source:MGI Symbol;Acc:MGI:1100859]
calpain 6 Gene [Source:MGI Symbol;Acc:MGI:1100850]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43148 Nonsense Mutation detected in F1 DNA During 2017
sa11881 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098972 Nonsense 158 685 4 21
ENSDART00000128707 Nonsense 158 717 4 21
Genomic Location (Zv9):
Chromosome 18 (position 35022925)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36702081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTGTGAGAGAGGGCCGTCTGCTTTTCAGCTACTCTCGCACCAGCAAC[G/T]AGTTCTGGAGCGCCCTGGTGGAGAAAGCTTATGCCAAGTCAGTTCCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098972 Essential Splice Site 498 685 12 21
ENSDART00000128707 Essential Splice Site 530 717 12 21
Genomic Location (Zv9):
Chromosome 18 (position 35042089)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36721245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGGAGTTTTTCCTCCGCATTTACACCAAAACTGGCAACWTACAAGGG[T/C]ATGCAGAATCACAAACAAACATCAGCTCTRAGTTTTGATTGCAGCTTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link