nod2

Ensembl ID:
ENSDARG00000010756
ZFIN ID:
ZDB-GENE-061108-4
Description:
CARD15 [Source:UniProtKB/TrEMBL;Acc:Q1AMZ9]
Human Orthologue:
NOD2
Human Description:
nucleotide-binding oligomerization domain containing 2 [Source:HGNC Symbol;Acc:5331]
Mouse Orthologue:
Nod2
Mouse Description:
nucleotide-binding oligomerization domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2429397]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21011 Nonsense Available for shipment Available now
sa10156 Nonsense Available for shipment Available now
sa18880 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052380 Nonsense 79 970 1 10
Genomic Location (Zv9):
Chromosome 7 (position 38955148)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37291788
KASP Assay ID:
2259-9172.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCATGCAGTTATTTTTTGGCTGCGATTGAGCAAGAATTAGCTGAGGAG[C/T]AAAAGGCTGGACTATGTTTTGGTAATGGATGCGTTATGGTGGGCAAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052380 Nonsense 911 970 8 10
ENSDART00000052380 Nonsense 911 970 8 10
Genomic Location (Zv9):
Chromosome 7 (position 38948801)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37285441
KASP Assay ID:
554-6143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATGGTGTGGGCAGTGCCGGTGCATGTGCTCTGGCTAAATTTATCCGA[C/T]AGAACAAAAGTCTGGAAGAATTGTGGTGAGTGSCTTCAGCTTTTTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052380 Nonsense 911 970 8 10
ENSDART00000052380 Nonsense 911 970 8 10
Genomic Location (Zv9):
Chromosome 7 (position 38948801)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37285441
KASP Assay ID:
554-6143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGGTGTGGGCAGTGCCGGTGCATGTGCTCTGGCTAAATTTATCCGA[C/T]AGAACAAAAGTCTGGAAGAATTGTGGTGAGTGGCTTCAGCTTTTTTTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link