acsl4l

Ensembl ID:
ENSDARG00000010752
ZFIN ID:
ZDB-GENE-030131-6493
Description:
acyl-CoA synthetase long-chain family member 4, like [Source:RefSeq peptide;Acc:NP_001093209]
Human Orthologue:
ACSL4
Human Description:
acyl-CoA synthetase long-chain family member 4 [Source:HGNC Symbol;Acc:3571]
Mouse Orthologue:
Acsl4
Mouse Description:
acyl-CoA synthetase long-chain family member 4 Gene [Source:MGI Symbol;Acc:MGI:1354713]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2271 Nonsense Mutation detected in F1 DNA During 2014
sa25296 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 155 671 4 15
Genomic Location:
Chromosome 5 (position 25236349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTYTGTATGCGACTCTGGGTGAAGATGCTGTTGCTTATGGGCTCAAT[C/T]AATGTGGCGCCACTCATCTCATCACCAGCACAGAACTGCTGCAAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 431 671 10 15
Genomic Location:
Chromosome 5 (position 25196573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTGTGTTTCTGCCCCATTGCTGTGGGTTATGGCCTTACAGAGACGTG[C/A]GGAGCTGGCACTATATCAGACTGTAAGTACACACAAAAAAAAGTGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gimcwwfg