acsl4l

Ensembl ID:
ENSDARG00000010752
ZFIN ID:
ZDB-GENE-030131-6493
Description:
acyl-CoA synthetase long-chain family member 4, like [Source:RefSeq peptide;Acc:NP_001093209]
Human Orthologue:
ACSL4
Human Description:
acyl-CoA synthetase long-chain family member 4 [Source:HGNC Symbol;Acc:3571]
Mouse Orthologue:
Acsl4
Mouse Description:
acyl-CoA synthetase long-chain family member 4 Gene [Source:MGI Symbol;Acc:MGI:1354713]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44604 Nonsense Mutation detected in F1 DNA During 2017
sa31432 Essential Splice Site Available for shipment Available now
sa25296 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 69 671 2 15
Genomic Location (Zv9):
Chromosome 5 (position 25240451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCACCCTGTTTGGGCACCAGAGAGGTGCTTAGCGAAGAAGAAGAAAAA[C/T]AACCCAATGGGAAGATCTTCAAAAAGGTATATTTATTGACTGACTAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Essential Splice Site 382 671 10 15
Genomic Location (Zv9):
Chromosome 5 (position 25196722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23023987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATATCTGCTCTTCATGTTTTGTCATATTGTAATTTTGTTTGTCTCTC[A/T]GGCTGTTCTTCAAGCAGGTGAATGTGCTTCTGGGAGGCTGTGTGCGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 431 671 10 15
Genomic Location (Zv9):
Chromosome 5 (position 25196573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23023838
KASP Assay ID:
554-7608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTGTGTTTCTGCCCCATTGCTGTGGGTTATGGCCTTACAGAGACGTG[C/A]GGAGCTGGCACTATATCAGACTGTAAGTACACACAAAAAAAAGTGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link