acsl4l

Ensembl ID:
ENSDARG00000010752
ZFIN ID:
ZDB-GENE-030131-6493
Description:
acyl-CoA synthetase long-chain family member 4, like [Source:RefSeq peptide;Acc:NP_001093209]
Human Orthologue:
ACSL4
Human Description:
acyl-CoA synthetase long-chain family member 4 [Source:HGNC Symbol;Acc:3571]
Mouse Orthologue:
Acsl4
Mouse Description:
acyl-CoA synthetase long-chain family member 4 Gene [Source:MGI Symbol;Acc:MGI:1354713]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2271 Nonsense Mutation detected in F1 DNA During 2016
sa31432 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25296 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 155 671 4 15
Genomic Location:
Chromosome 5 (position 25236349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTYTGTATGCGACTCTGGGTGAAGATGCTGTTGCTTATGGGCTCAAT[C/T]AATGTGGCGCCACTCATCTCATCACCAGCACAGAACTGCTGCAAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Essential Splice Site 382 671 10 15
Genomic Location:
Chromosome 5 (position 25196722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATATCTGCTCTTCATGTTTTGTCATATTGTAATTTTGTTTGTCTCTC[A/T]GGCTGTTCTTCAAGCAGGTGAATGTGCTTCTGGGAGGCTGTGTGCGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 431 671 10 15
Genomic Location:
Chromosome 5 (position 25196573)
KASP Assay ID:
554-7608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTGTGTTTCTGCCCCATTGCTGTGGGTTATGGCCTTACAGAGACGTG[C/A]GGAGCTGGCACTATATCAGACTGTAAGTACACACAAAAAAAAGTGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link