xrcc4

Ensembl ID:
ENSDARG00000010732
ZFIN ID:
ZDB-GENE-040426-1755
Description:
DNA repair protein XRCC4 [Source:RefSeq peptide;Acc:NP_957080]
Human Orthologue:
XRCC4
Human Description:
X-ray repair complementing defective repair in Chinese hamster cells 4 [Source:HGNC Symbol;Acc:12831
Mouse Orthologue:
Xrcc4
Mouse Description:
X-ray repair complementing defective repair in Chinese hamster cells 4 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34984 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34985 Nonsense Mutation detected in F1 DNA During 2016
sa13686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024644 Essential Splice Site 50 357 3 8
Genomic Location (Zv9):
Chromosome 10 (position 44609078)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43300391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTGTATTTTATTTGGTTTTAAACTCTAGCTCTGGTTGTTTTTTGTTC[A/C]GTTTCCGAGGAGGACGTGTCGCGGGAGGCTCGTGAGATGGAGATGGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024644 Nonsense 110 357 3 8
Genomic Location (Zv9):
Chromosome 10 (position 44609261)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43300574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGCTGACACCTGAGCGGCCCGGACGACCCCAACTGCAGCTGTCTTA[T/A]GAGAAGGTGCAGAAGGACATCTCGGTGAGTCTCGATGAATGACACTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024644 Nonsense 185 357 5 8
Genomic Location (Zv9):
Chromosome 10 (position 44629507)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43320840
KASP Assay ID:
2260-3684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTGTGTTTTTCAGGATGGAWCGATACGTGAAGGGAAAGGAGGCGT[T/A]AGAGAGAGACCTGTACRGCCGCTTTGTGCTGGTCCTCAATGAGAAGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link