xrcc4

Ensembl ID:
ENSDARG00000010732
ZFIN ID:
ZDB-GENE-040426-1755
Description:
DNA repair protein XRCC4 [Source:RefSeq peptide;Acc:NP_957080]
Human Orthologue:
XRCC4
Human Description:
X-ray repair complementing defective repair in Chinese hamster cells 4 [Source:HGNC Symbol;Acc:12831
Mouse Orthologue:
Xrcc4
Mouse Description:
X-ray repair complementing defective repair in Chinese hamster cells 4 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024644 Nonsense 185 357 5 8
Genomic Location:
Chromosome 10 (position 44629507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTGTGTTTTTCAGGATGGAWCGATACGTGAAGGGAAAGGAGGCGT[T/A]AGAGAGAGACCTGTACRGCCGCTTTGTGCTGGTCCTCAATGAGAAGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bub5769k