ttyh2l

Ensembl ID:
ENSDARG00000010727
ZFIN ID:
ZDB-GENE-040426-2394
Description:
Protein tweety homolog 2-like [Source:UniProtKB/Swiss-Prot;Acc:Q6NUZ2]
Human Orthologue:
TTYH2
Human Description:
tweety homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:13877]
Mouse Orthologue:
Ttyh2
Mouse Description:
tweety homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2157091]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17926 Nonsense Available for shipment Available now
sa6917 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38411 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008607 Nonsense 126 531 3 14
ENSDART00000137701 Nonsense 126 138 3 3
Genomic Location:
Chromosome 3 (position 52228011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACAGCGAAACCAACGATGGAGTCTACCAGTTGACTTACTCCATTTA[C/A]AATGCCAATCACACACTGGGTGGCATCGGCAGTAYGGTAAGAGTTTYGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008607 Essential Splice Site 292 531 7 14
ENSDART00000137701   None 138 None 3
Genomic Location:
Chromosome 3 (position 52259841)
KASP Assay ID:
554-5023.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTGACAAGTACATTGTCAATCAAACCAAAGGCACCTTGAGTTCAGG[T/C]AAGTAATATTTTACTGCTCCATATGCCTGTCTTTTGGATGCACCTGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008607 Splice Site, Nonsense 505 531 13 14
ENSDART00000137701   None 138 None 3
Genomic Location:
Chromosome 3 (position 52273620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCGCTATGAAAACGTCCCATTAATTGGGAGCGGTTCACCACCACCAT[C/A]GGTATTTTGATTCAAATCCTACATTTAATAAATAATTTATATTCATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link