ttyh2l

Ensembl ID:
ENSDARG00000010727
ZFIN ID:
ZDB-GENE-040426-2394
Description:
Protein tweety homolog 2-like [Source:UniProtKB/Swiss-Prot;Acc:Q6NUZ2]
Human Orthologue:
TTYH2
Human Description:
tweety homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:13877]
Mouse Orthologue:
Ttyh2
Mouse Description:
tweety homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2157091]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17926 Nonsense Available for shipment Available now
sa6917 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008607 Nonsense 126 531 3 14
ENSDART00000137701 Nonsense 126 138 3 3
Genomic Location:
Chromosome 3 (position 52228011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACAGCGAAACCAACGATGGAGTCTACCAGTTGACTTACTCCATTTA[C/A]AATGCCAATCACACACTGGGTGGCATCGGCAGTAYGGTAAGAGTTTYGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008607 Essential Splice Site 292 531 7 14
ENSDART00000137701 None None 138 None 3
Genomic Location:
Chromosome 3 (position 52259841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTGACAAGTACATTGTCAATCAAACCAAAGGCACCTTGAGTTCAGG[T/C]AAGTAATATTTTACTGCTCCATATGCCTGTCTTTTGGATGCACCTGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m3pbjz9c