sept6

Ensembl ID:
ENSDARG00000010721
ZFIN ID:
ZDB-GENE-030131-1414
Description:
septin-6 [Source:RefSeq peptide;Acc:NP_997791]
Human Orthologue:
SEPT6
Human Description:
septin 6 [Source:HGNC Symbol;Acc:15848]
Mouse Orthologue:
Sept6
Mouse Description:
septin 6 Gene [Source:MGI Symbol;Acc:MGI:1888939]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35719 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35718 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018750 Essential Splice Site 49 427 2 11
ENSDART00000136442   None 163 None 5
ENSDART00000137997 Essential Splice Site 54 432 2 11

The following transcripts of ENSDARG00000010721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34300595)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32985295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAACAAGTCCGTCAACCATGGTTTCTGCTTCAATATCCTCTGTGTGGG[T/C]GAGTGTGTCATGTGGGAGCTCCTTTTTACTTGGGGCAAAACTAAGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018750 Nonsense 56 427 3 11
ENSDART00000136442   None 163 None 5
ENSDART00000137997 Nonsense 61 432 3 11

The following transcripts of ENSDARG00000010721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34294611)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32979311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGATAAGCTGATGTGTTTTTGTTACAGGGGAGACGGGTTTGGGAAAGT[C/A]AACCCTCATGGACACCCTGTTTAACACCAAATTTGAGGGCGAACCTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link