chchd10

Ensembl ID:
ENSDARG00000010717
ZFIN ID:
ZDB-GENE-040426-1753
Description:
coiled-coil-helix-coiled-coil-helix domain-containing protein 10, mitochondrial [Source:RefSeq pept
Human Orthologue:
CHCHD10
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 10 [Source:HGNC Symbol;Acc:15559]
Mouse Orthologue:
Chchd10
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2143558]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024858 Nonsense 89 143 2 4
ENSDART00000146909 Nonsense 89 105 2 3
Genomic Location:
Chromosome 21 (position 13909101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTTCAGTGGAGGCAGCAGTTCAGAGGCACCCAAACCAGCACCCACATA[T/A]CAGGTCATACCCAAAATATTTATTGAAATATTATATTTTTATTTTNTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7vqyqfwf