msi1

Ensembl ID:
ENSDARG00000010710
ZFIN ID:
ZDB-GENE-050320-86
Description:
RNA-binding protein Musashi homolog 1 [Source:RefSeq peptide;Acc:NP_001013534]
Human Orthologue:
MSI1
Human Description:
musashi homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:7330]
Mouse Orthologue:
Msi1
Mouse Description:
Musashi homolog 1(Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107376]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5498 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8320 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041634 Essential Splice Site 88 329 4 13
ENSDART00000097427 Essential Splice Site 56 297 2 11
ENSDART00000134822 None None 215 None 9
ENSDART00000144293 None None 180 None 7

The following transcripts of ENSDARG00000010710 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 41560406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGACAAAGTCCTGGCCCAGACCAGACATGAGCTGGACTCCAAAACTG[T/C]GAGTTTTAATCATATTAAACTGTTGAGGAGCATTGAGTTGTGTTCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041634 Essential Splice Site 102 329 None 13
ENSDART00000097427 Essential Splice Site 70 297 None 11
ENSDART00000134822 Essential Splice Site 14 215 None 9
ENSDART00000144293 None None 180 None 7

The following transcripts of ENSDARG00000010710 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 41571776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTAGATCGACCCAAAAGTTGCCTTCCCTCGGCGAGCCCAGCCTAAGG[T/C]ATGTATGTTTCCGTTTGACTGGTCAACATAGTGGTCAGCAGGATGAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qkrf664w