il17d

Ensembl ID:
ENSDARG00000010700
ZFIN ID:
ZDB-GENE-061031-4
Description:
interleukin 17d [Source:RefSeq peptide;Acc:NP_001018625]
Human Orthologue:
IL17D
Human Description:
interleukin 17D [Source:HGNC Symbol;Acc:5984]
Mouse Orthologue:
Il17d
Mouse Description:
interleukin 17D Gene [Source:MGI Symbol;Acc:MGI:2446510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11263 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018251 Essential Splice Site 103 212 1 2
Genomic Location:
Chromosome 9 (position 22398386)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGCGAACACCGGTCAAYCTGCTCAGCCTYTCTCCTTGGGCGTACAGG[T/C]AACCGTAAACAACGGGAACAAGACTGTAAAACTAAATAATTTCATGATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z802zfq9