ENSDARG00000010690

Ensembl ID:
ENSDARG00000010690
Human Orthologue:
PRPF39
Human Description:
PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20314]
Mouse Orthologue:
Prpf39
Mouse Description:
PRP39 pre-mRNA processing factor 39 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:104602]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44376 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021944 Essential Splice Site 566 616 13 16
Genomic Location (Zv9):
Chromosome Zv9_scaffold3489 (position 123464)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46504469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAATGTTTTTCTGTATTTCTTCAGTGATTATGATGACCCAGAAAAGA[T/A]GAGCAAAATGGACGATATATCTGTCATGACGGTGCCACAGACAGCTCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link