si:dkey-109m21.1

Ensembl ID:
ENSDARG00000010681
ZFIN ID:
ZDB-GENE-081107-47
Description:
Novel protein similar to vertebrate brain-enriched guanylate kinase-associated homolog (Rat) (BEGAIN
Human Orthologue:
TJAP1
Human Description:
tight junction associated protein 1 (peripheral) [Source:HGNC Symbol;Acc:17949]
Mouse Orthologue:
Tjap1
Mouse Description:
tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5856 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058238   None 529 None 8
ENSDART00000132354 Nonsense 12 677 4 10
Genomic Location (Zv9):
Chromosome 13 (position 3713144)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3930064
KASP Assay ID:
554-3699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACTGATCTTCYAGAAWGACGAGTGCTGCACCTGCCCGGAAACCTTAC[C/T]GAAAGGCACCTCCGCAGCACCGCGAGACGCGTCACACTGTGCCAGTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link