ppm1k

Ensembl ID:
ENSDARG00000010655
ZFIN ID:
ZDB-GENE-050306-8
Description:
protein phosphatase 1K (PP2C domain containing) [Source:RefSeq peptide;Acc:NP_001013325]
Human Orthologue:
PPM1K
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1K [Source:HGNC Symbol;Acc:25415]
Mouse Orthologue:
Ppm1k
Mouse Description:
protein phosphatase 1K (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:2442111]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39688 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015591 Essential Splice Site 329 372 None 6
ENSDART00000048814 Essential Splice Site 118 161 None 8
ENSDART00000145550 Essential Splice Site 320 363 None 7

The following transcripts of ENSDARG00000010655 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 51103739)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49952830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCAATGTCATGACCCCAAAGAGGCCGCACAACGCATATCTGAGCAGG[T/G]CAGTCACATTATCCAACATCCCACAGGGTTTAACACTAAGGATTTTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link