ARHGAP42 (2 of 2)

Ensembl ID:
ENSDARG00000010654
Description:
Rho GTPase activating protein 42 [Source:HGNC Symbol;Acc:26545]
Human Orthologue:
ARHGAP42
Human Description:
Rho GTPase activating protein 42 [Source:HGNC Symbol;Acc:26545]
Mouse Orthologue:
Arhgap42
Mouse Description:
Rho GTPase activating protein 42 Gene [Source:MGI Symbol;Acc:MGI:1918794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13571 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019245 Nonsense 392 863 13 24
Genomic Location:
Chromosome 18 (position 40268868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCTATTGAACATGCTYTTTCTTGTTTCTTTGTGWAGCATATTTAAAT[G/T]AGRCTGGCTTTAATTTTGTGAGGAAGTGTATACAACTGGTGGAGGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8rvlhif3