themis

Ensembl ID:
ENSDARG00000010619
ZFIN ID:
ZDB-GENE-041008-160
Description:
Protein THEMIS [Source:UniProtKB/Swiss-Prot;Acc:A5PF62]
Human Orthologue:
THEMIS
Human Description:
thymocyte selection associated [Source:HGNC Symbol;Acc:21569]
Mouse Orthologues:
9130404H23Rik, Themis
Mouse Descriptions:
RIKEN cDNA 9130404H23 gene Gene [Source:MGI Symbol;Acc:MGI:1921806]
thymocyte selection associated Gene [Source:MGI Symbol;Acc:MGI:2443552]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36939 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36938 Nonsense Mutation detected in F1 DNA During 2016
sa3073 Nonsense F2 line generated During 2016
sa5946 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002928 Essential Splice Site 30 675 1 6
Genomic Location (Zv9):
Chromosome 20 (position 1462375)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1418240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACATCTGCCCCGAGTGTTGCACATCCAGTCCGGCATATACTACCAGG[G/T]TAAGAGGAGATGCTCACAATTACTTTTTCATTTTACTTTTGCTTTTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002928 Nonsense 299 675 4 6
Genomic Location (Zv9):
Chromosome 20 (position 1452390)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1408255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAACCATTTCAGACTCTCTCCCGACCTGGAGTCCCTTTTCCAGTCC[A/T]AAGAGGTGATTATTCATCACCCTTTCAAAGCCAAACGAATTCTAGCCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3073
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002928 Nonsense 311 675 4 6
Genomic Location (Zv9):
Chromosome 20 (position 1452354)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1408219
KASP Assay ID:
554-2929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTTTCCAGTCCAAAGAGGTRATTATTCATCACCCTTTCAAAGCCAAA[C/T]GAATTCTRGCCTCGGAAATGTGCCAGGAGTCMGCAAGACATTTTCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002928 Nonsense 336 675 4 6
Genomic Location (Zv9):
Chromosome 20 (position 1452279)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1408144
KASP Assay ID:
554-3743.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGTCMGCAAGACATTTTCTCATCCCGGAGTCCTACAACGGGCGCTTC[A/T]AGCGGCGTCCGCGGCAGTTCTCCACTGCATATGACCTAGAGCGGGCGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link