themis

Ensembl ID:
ENSDARG00000010619
ZFIN ID:
ZDB-GENE-041008-160
Description:
Protein THEMIS [Source:UniProtKB/Swiss-Prot;Acc:A5PF62]
Human Orthologue:
THEMIS
Human Description:
thymocyte selection associated [Source:HGNC Symbol;Acc:21569]
Mouse Orthologues:
9130404H23Rik, Themis
Mouse Descriptions:
RIKEN cDNA 9130404H23 gene Gene [Source:MGI Symbol;Acc:MGI:1921806]
thymocyte selection associated Gene [Source:MGI Symbol;Acc:MGI:2443552]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3073 Nonsense F2 line generated During 2014
sa5946 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3073
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002928 Nonsense 311 675 4 6
Genomic Location:
Chromosome 20 (position 1452354)
KASP Assay ID:
554-2929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTTTCCAGTCCAAAGAGGTRATTATTCATCACCCTTTCAAAGCCAAA[C/T]GAATTCTRGCCTCGGAAATGTGCCAGGAGTCMGCAAGACATTTTCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002928 Nonsense 336 675 4 6
Genomic Location:
Chromosome 20 (position 1452279)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGTCMGCAAGACATTTTCTCATCCCGGAGTCCTACAACGGGCGCTTC[A/T]AGCGGCGTCCGCGGCAGTTCTCCACTGCATATGACCTAGAGCGGGCGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b8orpowm