sarm1

Ensembl ID:
ENSDARG00000010610
ZFIN ID:
ZDB-GENE-040219-1
Description:
sterile alpha and TIR motif-containing protein 1 [Source:RefSeq peptide;Acc:NP_001124068]
Human Orthologue:
SARM1
Human Description:
sterile alpha and TIR motif containing 1 [Source:HGNC Symbol;Acc:17074]
Mouse Orthologue:
Sarm1
Mouse Description:
sterile alpha and HEAT/Armadillo motif containing 1 Gene [Source:MGI Symbol;Acc:MGI:2136419]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7407 Missense Mutation detected in F1 DNA During 2017
sa19119 Nonsense Mutation detected in F1 DNA During 2017
sa10409 Nonsense Available for shipment Available now
sa11193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Missense 319 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27547044)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265284
KASP Assay ID:
554-4374.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTTTGCGCGTAACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAA[C/T]GGCTGCAGATCTGCAACACCTGCTGCCTCTGCTGGATGGCACAYGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 324 713 2 8
ENSDART00000004200 Nonsense 324 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27547030)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265270
KASP Assay ID:
2260-8595.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAACGGCTGCAGATCTG[C/T]AACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAGGGCAAATGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 324 713 2 8
ENSDART00000004200 Nonsense 324 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27547030)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265270
KASP Assay ID:
2260-8595.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAAYGGCTGCAGATCTG[C/T]AACACCTGCTGCCTCTGCTGGATGGCACAYGTCTGGAGGGCAAATGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 344 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27546968)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTGCTGGATGGCACAYGTCTGGAGGGCAAATGCATCGCTGCTTTTTA[C/A]YTGTGTGTRGAGACTAGCATCAAATCACGACAACGTAATACYAAGGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link