mtmr10

Ensembl ID:
ENSDARG00000010601
ZFIN ID:
ZDB-GENE-061103-52
Description:
Myotubularin-related protein 10 [Source:UniProtKB/Swiss-Prot;Acc:A0JMF6]
Human Orthologue:
MTMR10
Human Description:
myotubularin related protein 10 [Source:HGNC Symbol;Acc:25999]
Mouse Orthologues:
Mtmr10, Sbf2
Mouse Descriptions:
myotubularin related protein 10 Gene [Source:MGI Symbol;Acc:MGI:2142292]
SET binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1921831]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40920 Nonsense Mutation detected in F1 DNA During 2016
sa18004 Nonsense Available for shipment Available now
sa40921 Nonsense Mutation detected in F1 DNA During 2016
sa7597 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Nonsense 22 752 2 16
ENSDART00000127131 Nonsense 22 765 2 16
Genomic Location (Zv9):
Chromosome 7 (position 32062993)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30455335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATACTTGTACAGTGAGTTATAAGTGTTTATGTTTCACAGACCGATT[T/A]GAAGAAAAGTCCACAACTGCCTATCAAGAAGCTAGAAGCAAAACTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Nonsense 375 752 12 16
ENSDART00000127131 Nonsense 375 765 12 16
ENSDART00000085716 Nonsense 375 752 12 16
ENSDART00000127131 Nonsense 375 765 12 16
Genomic Location (Zv9):
Chromosome 7 (position 32099561)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30491903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTCKTTTAACAGGACATTTTTGCGGCACGCAGTRGAGGTAGTCTA[T/A]ATGCTKGAGAGCAGGCATGTGTCTGTCATACTCCTTGGTAAGAAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Nonsense 375 752 12 16
ENSDART00000127131 Nonsense 375 765 12 16
ENSDART00000085716 Nonsense 375 752 12 16
ENSDART00000127131 Nonsense 375 765 12 16
Genomic Location (Zv9):
Chromosome 7 (position 32099561)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30491903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTCGTTTAACAGGACATTTTTGCGGCACGCAGTGGAGGTAGTCTA[T/G]ATGCTTGAGAGCAGGCATGTGTCTGTCATACTCCTTGGTAAGAAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Missense 720 752 16 16
ENSDART00000127131 Missense 733 765 16 16
Genomic Location (Zv9):
Chromosome 7 (position 32104800)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30497142
KASP Assay ID:
554-4352.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCWCCAGRATACCTCAGCTCCTCGTTTCCCTTCTCTCCTGTGGGCAA[T/G]CTGTGTCGGCCCGGCATTTTGGGGACTCCTCTGAGCAAGTTYCTYAACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link