mtmr10

Ensembl ID:
ENSDARG00000010601
ZFIN ID:
ZDB-GENE-061103-52
Description:
Myotubularin-related protein 10 [Source:UniProtKB/Swiss-Prot;Acc:A0JMF6]
Human Orthologue:
MTMR10
Human Description:
myotubularin related protein 10 [Source:HGNC Symbol;Acc:25999]
Mouse Orthologues:
Mtmr10, Sbf2
Mouse Descriptions:
myotubularin related protein 10 Gene [Source:MGI Symbol;Acc:MGI:2142292]
SET binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1921831]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5424 Nonsense Mutation detected in F1 DNA During 2014
sa18004 Nonsense Available for shipment Available now
sa7597 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Nonsense 84 752 3 16
ENSDART00000127131 Nonsense 84 765 3 16
Genomic Location:
Chromosome 7 (position 32075910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTACCAACTTCAAGGTCTCCTTCATTTCCCATAATTCATTGCCA[C/T]AGCAGGTAAGCTCAGACTTGTCAGAGTCATTTTTTTCTATAACCTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Nonsense 375 752 12 16
ENSDART00000127131 Nonsense 375 765 12 16
Genomic Location:
Chromosome 7 (position 32099561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTCKTTTAACAGGACATTTTTGCGGCACGCAGTRGAGGTAGTCTA[T/A]ATGCTKGAGAGCAGGCATGTGTCTGTCATACTCCTTGGTAAGAAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085716 Missense 720 752 16 16
ENSDART00000127131 Missense 733 765 16 16
Genomic Location:
Chromosome 7 (position 32104800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCWCCAGRATACCTCAGCTCCTCGTTTCCCTTCTCTCCTGTGGGCAA[T/G]CTGTGTCGGCCCGGCATTTTGGGGACTCCTCTGAGCAAGTTYCTYAACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o8jn4w6i