foxn4

Ensembl ID:
ENSDARG00000010591
ZFIN ID:
ZDB-GENE-990415-277
Description:
forkhead box protein N4 [Source:RefSeq peptide;Acc:NP_571174]
Human Orthologue:
FOXN4
Human Description:
forkhead box N4 [Source:HGNC Symbol;Acc:21399]
Mouse Orthologue:
Foxn4
Mouse Description:
forkhead box N4 Gene [Source:MGI Symbol;Acc:MGI:2151057]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33562 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008994 Essential Splice Site 269 550 7 10
ENSDART00000126690 Essential Splice Site None 92 5 8

The following transcripts of ENSDARG00000010591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 21174650)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18887522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGAGTGAGATCTACAGCTTTATGAAAGAGCACTTCCCTTACTTCAAG[G/A]TGAGGAATTTGAATAAAACTATGCTGGTAAATTAGAATTAATGAATGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link