ezh2

Ensembl ID:
ENSDARG00000010571
ZFIN ID:
ZDB-GENE-041111-259
Description:
Histone-lysine N-methyltransferase EZH2 [Source:UniProtKB/Swiss-Prot;Acc:Q08BS4]
Human Orthologue:
EZH2
Human Description:
enhancer of zeste homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3527]
Mouse Orthologue:
Ezh2
Mouse Description:
enhancer of zeste homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107940]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1199 Nonsense Available for shipment Available now
sa1900 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa1199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024722 Nonsense 18 760 2 20
Genomic Location:
Chromosome 24 (position 17898340)
KASP Assay ID:
554-1108.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGATTGACCGGGAGGAAATCGGAGAAGGGYCCTGTTTGCTGGAGGCGG[C/T]GAGTGAAGTCTGAGTACATGCGGCTGCGGCAGCTCAAACGCTTCAGGAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1900
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024722 Essential Splice Site 712 760 18 20
Genomic Location:
Chromosome 24 (position 17909474)
KASP Assay ID:
554-1890.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGATCAGATTTGCCAACCACTCGGTGAACCCCAACTGCTATGCAAAAG[G/A]TAAACCATCCTCCATCTTGTGCTGAGAAGATCTAGAGTGTGAACTGTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ncp6x609