aqp4

Ensembl ID:
ENSDARG00000010565
ZFIN ID:
ZDB-GENE-040724-152
Description:
aquaporin-4 [Source:RefSeq peptide;Acc:NP_001003749]
Human Orthologue:
AQP4
Human Description:
aquaporin 4 [Source:HGNC Symbol;Acc:637]
Mouse Orthologue:
Aqp4
Mouse Description:
aquaporin 4 Gene [Source:MGI Symbol;Acc:MGI:107387]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23663 Essential Splice Site Available for shipment Available now
sa17194 Nonsense Available for shipment Available now
sa32284 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011287 Essential Splice Site 11 320 1 5
ENSDART00000136130   None 309 None 4
Genomic Location (Zv9):
Chromosome 20 (position 18209351)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18263851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGTCTGAGGAGGAATGACAAGCTGTGGAGCCCTGGACACATTCAG[G/A]TGAGTTCAAGAGCAAAAGTGCTGGATACTCACATGATCAGTAGCATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011287 Nonsense 137 320 2 5
ENSDART00000136130 Nonsense 126 309 1 4
Genomic Location (Zv9):
Chromosome 20 (position 18214695)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18269195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTTGGCACAGTGTTTGGGGGCAGTAGTGGGAGCAGCCATCTTGTAT[G/T]GAGTGACACCGGCRTCAGTGAGAGGAGGAATGGGAGTGACGTCTGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011287 Nonsense 229 320 4 5
ENSDART00000136130 Nonsense 218 309 3 4
Genomic Location (Zv9):
Chromosome 20 (position 18222660)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18277160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGAATCCAGCTCGCTCTTTTGGTCCCGCAGTCATCATGGTAAAATG[G/A]CAGGACCATTGGGTAAGATTTTCACAATATCTTCTGCTTGTAAATAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link