aqp4

Ensembl ID:
ENSDARG00000010565
ZFIN ID:
ZDB-GENE-040724-152
Description:
aquaporin-4 [Source:RefSeq peptide;Acc:NP_001003749]
Human Orthologue:
AQP4
Human Description:
aquaporin 4 [Source:HGNC Symbol;Acc:637]
Mouse Orthologue:
Aqp4
Mouse Description:
aquaporin 4 Gene [Source:MGI Symbol;Acc:MGI:107387]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23663 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17194 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011287 Essential Splice Site 11 320 1 5
ENSDART00000136130 None None 309 None 4
Genomic Location:
Chromosome 20 (position 18209351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGTCTGAGGAGGAATGACAAGCTGTGGAGCCCTGGACACATTCAG[G/A]TGAGTTCAAGAGCAAAAGTGCTGGATACTCACATGATCAGTAGCATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011287 Nonsense 137 320 2 5
ENSDART00000136130 Nonsense 126 309 1 4
Genomic Location:
Chromosome 20 (position 18214695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTTGGCACAGTGTTTGGGGGCAGTAGTGGGAGCAGCCATCTTGTAT[G/T]GAGTGACACCGGCRTCAGTGAGAGGAGGAATGGGAGTGACGTCTGTGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/guaspm6l