LOC100333601

Ensembl ID:
ENSDARG00000010556
Human Orthologue:
MMP25
Human Description:
matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246]
Mouse Orthologue:
Mmp25
Mouse Description:
matrix metallopeptidase 25 Gene [Source:MGI Symbol;Acc:MGI:2443938]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41941 Nonsense Mutation detected in F1 DNA During 2016
sa35194 Nonsense Mutation detected in F1 DNA During 2016
sa41942 Nonsense Mutation detected in F1 DNA During 2016
sa22003 Essential Splice Site Available for shipment Available now
sa22004 Nonsense Mutation detected in F1 DNA During 2016
sa22005 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41943 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Nonsense 6 573 1 10
Genomic Location (Zv9):
Chromosome 12 (position 4941311)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4224028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGTGAATAAAGGTCTCCACCAGCACACACATGAGTTTCTCAGGATA[T/G]CTTGGTCTGGTTTACCTGACCTGCCCTATGCTTGTGTTCTTCTCTGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Nonsense 75 573 2 10
Genomic Location (Zv9):
Chromosome 12 (position 4943415)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4226132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACGGCATCGAGAGAGCCATTAGAGAAATGCAGAGATTCGCTGGACTC[A/T]AGGAAACAGGCAAACTCGGTACATAATTCTGATCACACATAATTACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Nonsense 109 573 3 10
Genomic Location (Zv9):
Chromosome 12 (position 4946788)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4229505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTTCTCTGCCAGACATCATAGGCATTGAGGACAAGCTGAAAAAGCGC[A/T]GAAGGAAAAGATACGCAACCACTGGGCTCCGCTGGACAAAGTCTGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Essential Splice Site 225 573 5 10
Genomic Location (Zv9):
Chromosome 12 (position 4949219)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4231936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGCCACTTATCTACACATGTCCTGTTCTTATTCTCTGTATATTTTC[A/T]GATGAAAGCGGCACTGATTTGTTTGCGGTTGCGGTGCATGAGTTTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Nonsense 258 573 5 10
Genomic Location (Zv9):
Chromosome 12 (position 4949321)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4232038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGGGTCTTTCTCACTCCTCCTCTTCCCCCTCCATCATGAAGCCCTA[T/G]TATCAGGGCTCTGTTGGAGATGTAGGATCCTACATTCTTCCGGACGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Essential Splice Site 341 573 7 10
Genomic Location (Zv9):
Chromosome 12 (position 4953378)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4236095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTTTGATGCAGTGGCGAACCTCAGAGGAGAAGTTTTCTTTTTTAAAG[G/A]TACAGTGCAATAACAATTTCTACAATGTAGAGATTTTGTAAACCAGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Essential Splice Site 392 573 8 10
Genomic Location (Zv9):
Chromosome 12 (position 4956290)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4239007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGCAGTCTATGAAAGAAAGGTGGACAACGCAATCATCTTCTTCATAG[G/A]TTGGTCTCTCTTTATTTGCAGTGAAAAATATATGGAACAATTGATTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link