LOC100333601

Ensembl ID:
ENSDARG00000010556
Human Orthologue:
MMP25
Human Description:
matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246]
Mouse Orthologue:
Mmp25
Mouse Description:
matrix metallopeptidase 25 Gene [Source:MGI Symbol;Acc:MGI:2443938]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22003 Essential Splice Site Available for shipment Available now
sa22004 Nonsense Mutation detected in F1 DNA During 2014
sa22005 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Essential Splice Site 225 573 5 10
Genomic Location:
Chromosome 12 (position 4949219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGCCACTTATCTACACATGTCCTGTTCTTATTCTCTGTATATTTTC[A/T]GATGAAAGCGGCACTGATTTGTTTGCGGTTGCGGTGCATGAGTTTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Nonsense 258 573 5 10
Genomic Location:
Chromosome 12 (position 4949321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGGGTCTTTCTCACTCCTCCTCTTCCCCCTCCATCATGAAGCCCTA[T/G]TATCAGGGCTCTGTTGGAGATGTAGGATCCTACATTCTTCCGGACGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081382 Essential Splice Site 341 573 7 10
Genomic Location:
Chromosome 12 (position 4953378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTTTGATGCAGTGGCGAACCTCAGAGGAGAAGTTTTCTTTTTTAAAG[G/A]TACAGTGCAATAACAATTTCTACAATGTAGAGATTTTGTAAACCAGGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p6vjn9v6