pdha1b

Ensembl ID:
ENSDARG00000010555
ZFIN ID:
ZDB-GENE-040718-96
Description:
pyruvate dehydrogenase E1 alpha 1 [Source:RefSeq peptide;Acc:NP_001002399]
Human Orthologues:
PDHA1, PDHA2
Human Descriptions:
pyruvate dehydrogenase (lipoamide) alpha 1 [Source:HGNC Symbol;Acc:8806]
pyruvate dehydrogenase (lipoamide) alpha 2 [Source:HGNC Symbol;Acc:8807]
Mouse Orthologues:
Pdha1, Pdha2
Mouse Descriptions:
pyruvate dehydrogenase E1 alpha 1 Gene [Source:MGI Symbol;Acc:MGI:97532]
pyruvate dehydrogenase E1 alpha 2 Gene [Source:MGI Symbol;Acc:MGI:97533]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39453 Nonsense Mutation detected in F1 DNA During 2017
sa37894 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018420 Nonsense 72 393 3 11
ENSDART00000123299 Nonsense 79 400 4 12
ENSDART00000146482 Nonsense 79 165 4 6
Genomic Location (Zv9):
Chromosome 24 (position 24887053)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24133931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGACGGTGCTCACCAGAGAGGATGGACTCAAGTACTATCGCATGATG[C/T]AGACCATGAGACGCATGGAGCTGAAGGCAGATCAGCTTTACAAGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018420 Nonsense 150 393 5 11
ENSDART00000123299 Nonsense 157 400 6 12
ENSDART00000146482 Nonsense 157 165 6 6
Genomic Location (Zv9):
Chromosome 24 (position 24884542)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24131420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTAAACATGTAACTGTGTCTATTTCAGGCAGAAGGGGTGGTGTTGCT[A/T]AAGGCAAGGGCGGCTCTATGCACATGTATGCCAAGAATTTCTATGGCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link